G708715



Basic Information


Item Value
gene id G708715
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 41676777 ~ 41680717 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU805928
aggtaagtttgttgcaccccatatacagtcagtgtacagtaccattgccacctactgtccggtatgtatgcaggtatatgtactacaaccagcaataccaagaaaggctggttgtaaagcacatatacctgcatacatactggactggatactggatatcagattttagcccctgctagggcagactgcacacagacagcagaactggggacagatatgcagggacagactggcagagtcagggagtctcaggtaagtttgttgcaccccatatacagtcagtgtacagtaccattgccacctactgtccagtatgtatgcaggtatatgtactacaaccagcaataccaagaaaggctggttgtatgtagcacatatacctgcacacatactggac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU805928 True 397 lncRNA 0.46 2 41676777 41680717
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529916 LOC106571797 coding downstream 707299 40958142 ~ 40969478 (-)
LOC118965517 NA coding downstream 876740 40779851 ~ 40800037 (-)
LOC110529912 LOC106571799 coding downstream 897146 40724397 ~ 40779631 (-)
armc2 armc2 coding downstream 1007276 40638271 ~ 40669501 (-)
LOC118965516 LOC106588149 coding downstream 1531584 40143911 ~ 40145193 (-)
LOC118965611 NA coding upstream 44804 41725469 ~ 41728987 (-)
klhl18 klhl18 coding upstream 659965 42340682 ~ 42420087 (-)
puf60a puf60 coding upstream 751074 42431791 ~ 42526586 (-)
mycb myc coding upstream 1919037 43599754 ~ 43602305 (-)
LOC118965613 NA coding upstream 2078612 43759329 ~ 43763318 (-)
G708653 NA non-coding downstream 15150 41402045 ~ 41661627 (-)
G708707 NA non-coding downstream 36722 41620080 ~ 41640055 (-)
G708690 NA non-coding downstream 125600 41521486 ~ 41551177 (-)
G708684 NA non-coding downstream 184757 41484407 ~ 41492020 (-)
G708654 NA non-coding downstream 193080 41464211 ~ 41483697 (-)
G708729 NA non-coding upstream 24987 41705704 ~ 41722567 (-)
G708738 NA non-coding upstream 73728 41754445 ~ 41762538 (-)
G708745 NA non-coding upstream 76274 41756991 ~ 41763423 (-)
G708758 NA non-coding upstream 170184 41850901 ~ 41867282 (-)
slc22a16 LOC106571810 other downstream 1717164 39956961 ~ 40017167 (-)
G706683 stxbp5 other downstream 2450464 39219644 ~ 39226313 (-)
G704874 NA other downstream 3362974 38313489 ~ 38313803 (-)
G704702 NA other downstream 3638431 38037725 ~ 38038346 (-)
LOC110530908 otof other downstream 4184620 37474229 ~ 37626960 (-)
G709272 NA other upstream 1039054 42719771 ~ 42720699 (-)
G709454 NA other upstream 1490043 43170760 ~ 43171082 (-)
G711133 NA other upstream 2858076 44538793 ~ 44539504 (-)
G712814 NA other upstream 3777060 45457777 ~ 45458248 (-)
crfb16 LOC106568648 other upstream 4630413 46309732 ~ 46325685 (-)

Expression


G708715 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G708715 Expression in each Bioproject

Bar chart with 6 bars.
G708715 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network