G708852



Basic Information


Item Value
gene id G708852
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 42326342 ~ 42326630 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU806114
cacacgtcagatatacagtggtgcaaaaaagtatttagtcagccaccaattgtgcatgttctcccacttaaaaatatgtaattttcatcataggtacacttcaactatgacagacagtatttggtcatctacaaacaagcaagatttctggctctcacagacctgtaaattcttctttaagaggctcctctgtactccactcgttacctgtattaatggcacctgtttgaacttgttatcagtataaaagacacctgtccacaacctcaaacagtcacacaccaaactc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU806114 True 289 lncRNA 0.39 1 42326342 42326630
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118965611 NA coding downstream 597355 41725469 ~ 41728987 (-)
LOC110529916 LOC106571797 coding downstream 1356864 40958142 ~ 40969478 (-)
LOC118965517 NA coding downstream 1526305 40779851 ~ 40800037 (-)
LOC110529912 LOC106571799 coding downstream 1546711 40724397 ~ 40779631 (-)
armc2 armc2 coding downstream 1656841 40638271 ~ 40669501 (-)
klhl18 klhl18 coding upstream 14052 42340682 ~ 42420087 (-)
puf60a puf60 coding upstream 105161 42431791 ~ 42526586 (-)
mycb myc coding upstream 1273124 43599754 ~ 43602305 (-)
LOC118965613 NA coding upstream 1432699 43759329 ~ 43763318 (-)
efr3a efr3a coding upstream 1858363 44184993 ~ 44436559 (-)
G708827 NA non-coding downstream 15697 42246963 ~ 42310645 (-)
G708736 NA non-coding downstream 35257 41974081 ~ 42291085 (-)
G708740 NA non-coding downstream 42056 42280699 ~ 42284286 (-)
G708830 NA non-coding downstream 66626 42258575 ~ 42259716 (-)
G708820 NA non-coding downstream 107844 42216344 ~ 42218498 (-)
G709096 NA non-coding upstream 102788 42429418 ~ 42430176 (-)
G709197 NA non-coding upstream 253645 42580275 ~ 42627363 (-)
G709263 NA non-coding upstream 384913 42711543 ~ 42711868 (-)
G709282 NA non-coding upstream 404268 42730898 ~ 42741496 (-)
G709322 NA non-coding upstream 728988 43055618 ~ 43060881 (-)
slc22a16 LOC106571810 other downstream 2366729 39956961 ~ 40017167 (-)
G706683 stxbp5 other downstream 3100029 39219644 ~ 39226313 (-)
G704874 NA other downstream 4012539 38313489 ~ 38313803 (-)
G704702 NA other downstream 4287996 38037725 ~ 38038346 (-)
LOC110530908 otof other downstream 4834185 37474229 ~ 37626960 (-)
G709272 NA other upstream 393141 42719771 ~ 42720699 (-)
G709454 NA other upstream 844130 43170760 ~ 43171082 (-)
G711133 NA other upstream 2212163 44538793 ~ 44539504 (-)
G712814 NA other upstream 3131147 45457777 ~ 45458248 (-)
crfb16 LOC106568648 other upstream 3984500 46309732 ~ 46325685 (-)

Expression


G708852 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G708852 Expression in each Bioproject

Bar chart with 13 bars.
G708852 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network