G709454



Basic Information


Item Value
gene id G709454
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 43170760 ~ 43171082 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU806781
ttgttggtaatcaagcctaccactgttgtgtcgtccgcaaacttgatgattgagttggaggcgtgcgtggccacgcagtcgtgggtgaacagggagtacaggagagggctcagaacgcacccttgtgggggccccagtgttgaggatcagcggggtggaaatgttgttgcctaccctcaccacctggggatggcccgtcaggaagtccagtacccagttgcacagggcggggtcgagacccagggtctcgagcttgatgacgagcttggagggtactatggtgttaaatgctgagctgtagtcgatgaacagcattctcacat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU806781 True 323 TUCP 0.56 1 43170760 43171082
Loading

Neighbor


gene id symbol gene type direction distance location
puf60a puf60 coding downstream 644174 42431791 ~ 42526586 (-)
klhl18 klhl18 coding downstream 750673 42340682 ~ 42420087 (-)
LOC118965611 NA coding downstream 1441773 41725469 ~ 41728987 (-)
LOC110529916 LOC106571797 coding downstream 2201282 40958142 ~ 40969478 (-)
LOC118965517 NA coding downstream 2370723 40779851 ~ 40800037 (-)
mycb myc coding upstream 428672 43599754 ~ 43602305 (-)
LOC118965613 NA coding upstream 588247 43759329 ~ 43763318 (-)
efr3a efr3a coding upstream 1013911 44184993 ~ 44436559 (-)
LOC110529930 NA coding upstream 1219796 44390878 ~ 44394639 (-)
LOC110529115 NA coding upstream 1809887 44980969 ~ 44984268 (-)
G709426 NA non-coding downstream 35427 43135034 ~ 43135333 (-)
G709375 NA non-coding downstream 68352 43102205 ~ 43102408 (-)
G709358 NA non-coding downstream 79109 43091418 ~ 43091651 (-)
G709355 NA non-coding downstream 82264 43088204 ~ 43088496 (-)
G709347 NA non-coding downstream 87363 43083116 ~ 43083397 (-)
G709482 NA non-coding upstream 19511 43190593 ~ 43190854 (-)
G709483 NA non-coding upstream 20227 43191309 ~ 43191600 (-)
G709519 NA non-coding upstream 42444 43213526 ~ 43213917 (-)
G709597 NA non-coding upstream 99572 43270654 ~ 43270857 (-)
G709603 NA non-coding upstream 105240 43276322 ~ 43276523 (-)
G709272 NA other downstream 450061 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 3211147 39956961 ~ 40017167 (-)
G706683 stxbp5 other downstream 3944447 39219644 ~ 39226313 (-)
G704874 NA other downstream 4856957 38313489 ~ 38313803 (-)
G704702 NA other downstream 5132414 38037725 ~ 38038346 (-)
G711133 NA other upstream 1367711 44538793 ~ 44539504 (-)
G712814 NA other upstream 2286695 45457777 ~ 45458248 (-)
crfb16 LOC106568648 other upstream 3140048 46309732 ~ 46325685 (-)
LOC110529973 LOC106568664 other upstream 3880385 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 4007342 47178424 ~ 47178736 (-)

Expression


G709454 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G709454 Expression in each Bioproject

Bar chart with 20 bars.
G709454 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network