G709667



Basic Information


Item Value
gene id G709667
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 43380559 ~ 43381176 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU807033
catttcagatcaccagttgcacatttcagatcaccagttgcacggaggaaaatcgttacttttgactttgacttttgacttcctatgacatcatattgcaaatggagaaaacatatgccttatgcacaagtaaaacaaaaataaatatgataatacaagttgacaaaggtatagtttgagcaaagtaaagtttgaattttgagcatgacaaattcgtgatggtacctgcccattaaaacatattgcaaatgcacagtgactttgaaaaagt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU807033 True 271 lncRNA 0.34 2 43380559 43381176
Loading

Neighbor


gene id symbol gene type direction distance location
puf60a puf60 coding downstream 853973 42431791 ~ 42526586 (-)
klhl18 klhl18 coding downstream 960472 42340682 ~ 42420087 (-)
LOC118965611 NA coding downstream 1651572 41725469 ~ 41728987 (-)
LOC110529916 LOC106571797 coding downstream 2411081 40958142 ~ 40969478 (-)
LOC118965517 NA coding downstream 2580522 40779851 ~ 40800037 (-)
mycb myc coding upstream 218578 43599754 ~ 43602305 (-)
LOC118965613 NA coding upstream 378153 43759329 ~ 43763318 (-)
efr3a efr3a coding upstream 803817 44184993 ~ 44436559 (-)
LOC110529930 NA coding upstream 1009702 44390878 ~ 44394639 (-)
LOC110529115 NA coding upstream 1599793 44980969 ~ 44984268 (-)
G709663 NA non-coding downstream 2895 43374947 ~ 43377664 (-)
G709639 NA non-coding downstream 3467 43290831 ~ 43377092 (-)
G709662 NA non-coding downstream 7717 43369730 ~ 43372842 (-)
G709661 NA non-coding downstream 9964 43364017 ~ 43370595 (-)
G709657 NA non-coding downstream 18082 43356568 ~ 43362477 (-)
G709835 NA non-coding upstream 139249 43520425 ~ 43520797 (-)
G710488 NA non-coding upstream 206508 43587684 ~ 43588262 (-)
G710490 NA non-coding upstream 208479 43589655 ~ 43589884 (-)
G710781 NA non-coding upstream 662470 44043646 ~ 44043959 (-)
G710785 NA non-coding upstream 671854 44053030 ~ 44056352 (-)
G709454 NA other downstream 209477 43170760 ~ 43171082 (-)
G709272 NA other downstream 659860 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 3420946 39956961 ~ 40017167 (-)
G706683 stxbp5 other downstream 4154246 39219644 ~ 39226313 (-)
G704874 NA other downstream 5066756 38313489 ~ 38313803 (-)
G711133 NA other upstream 1157617 44538793 ~ 44539504 (-)
G712814 NA other upstream 2076601 45457777 ~ 45458248 (-)
crfb16 LOC106568648 other upstream 2929954 46309732 ~ 46325685 (-)
LOC110529973 LOC106568664 other upstream 3670291 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 3797248 47178424 ~ 47178736 (-)

Expression


G709667 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G709667 Expression in each Bioproject

Bar chart with 16 bars.
G709667 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network