G710781



Basic Information


Item Value
gene id G710781
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 44043646 ~ 44043959 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU808198
gagggctcagaacgcacccttgtggggccccagtgttgaggatcagaggggaggagatgttgttgcctaccctcaccacctgggggcggcccgtcaggaagtccagtacccagttgcacagggcggggtcgagacccagggtctcgagcttgatgacgagcttggagggtactatggtgttgaatgccgagctgtagtcgatgaacagcattctcacataggtattcctcttgtccagatgggctagggcagtgtgcagtgtggttgagattgcatcgtctgtggacctatttgggcggtaagcaaattggagt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU808198 True 314 lncRNA 0.57 1 44043646 44043959
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118965613 NA coding downstream 280328 43759329 ~ 43763318 (-)
mycb myc coding downstream 441341 43599754 ~ 43602305 (-)
puf60a puf60 coding downstream 1517060 42431791 ~ 42526586 (-)
klhl18 klhl18 coding downstream 1623559 42340682 ~ 42420087 (-)
LOC118965611 NA coding downstream 2314659 41725469 ~ 41728987 (-)
efr3a efr3a coding upstream 141034 44184993 ~ 44436559 (-)
LOC110529930 NA coding upstream 346919 44390878 ~ 44394639 (-)
LOC110529115 NA coding upstream 937010 44980969 ~ 44984268 (-)
basp1 NA coding upstream 1078124 45122083 ~ 45173741 (-)
znf622 znf622 coding upstream 1441059 45485018 ~ 45495101 (-)
G710490 NA non-coding downstream 453762 43589655 ~ 43589884 (-)
G710488 NA non-coding downstream 455384 43587684 ~ 43588262 (-)
G709835 NA non-coding downstream 522849 43520425 ~ 43520797 (-)
G709667 NA non-coding downstream 662470 43380559 ~ 43381176 (-)
G709663 NA non-coding downstream 665982 43374947 ~ 43377664 (-)
G710785 NA non-coding upstream 9071 44053030 ~ 44056352 (-)
G710800 NA non-coding upstream 23980 44067939 ~ 44068194 (-)
G710795 NA non-coding upstream 24904 44068863 ~ 44069201 (-)
G710793 NA non-coding upstream 26734 44070693 ~ 44071246 (-)
G710796 NA non-coding upstream 27657 44071616 ~ 44072056 (-)
G709454 NA other downstream 872564 43170760 ~ 43171082 (-)
G709272 NA other downstream 1322947 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 4084033 39956961 ~ 40017167 (-)
G706683 stxbp5 other downstream 4817333 39219644 ~ 39226313 (-)
G704874 NA other downstream 5729843 38313489 ~ 38313803 (-)
G711133 NA other upstream 494834 44538793 ~ 44539504 (-)
G712814 NA other upstream 1413818 45457777 ~ 45458248 (-)
crfb16 LOC106568648 other upstream 2267171 46309732 ~ 46325685 (-)
LOC110529973 LOC106568664 other upstream 3007508 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 3134465 47178424 ~ 47178736 (-)

Expression


G710781 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G710781 Expression in each Bioproject

Bar chart with 18 bars.
G710781 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network