G710800



Basic Information


Item Value
gene id G710800
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 44067939 ~ 44068194 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU808219
aattagttggtaacataggtaagatgttttatattcatcatatgtttgtaagttacttctcatcagaatgtgtttgtataatactgtggcggggttgcagtatctgttctatgtcaagactaagttacttgggccggagagaggggagaggtcaagcgtgtatctcttggctccacaatgtctgtgtgccagtcaatgtgtctctgtgatcttgtcaagataggatggatttgatatatggctgttgatatggagg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU808219 True 256 lncRNA 0.41 1 44067939 44068194
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118965613 NA coding downstream 304621 43759329 ~ 43763318 (-)
mycb myc coding downstream 465634 43599754 ~ 43602305 (-)
puf60a puf60 coding downstream 1541353 42431791 ~ 42526586 (-)
klhl18 klhl18 coding downstream 1647852 42340682 ~ 42420087 (-)
LOC118965611 NA coding downstream 2338952 41725469 ~ 41728987 (-)
efr3a efr3a coding upstream 116799 44184993 ~ 44436559 (-)
LOC110529930 NA coding upstream 322684 44390878 ~ 44394639 (-)
LOC110529115 NA coding upstream 912775 44980969 ~ 44984268 (-)
basp1 NA coding upstream 1053889 45122083 ~ 45173741 (-)
znf622 znf622 coding upstream 1416824 45485018 ~ 45495101 (-)
G710785 NA non-coding downstream 11587 44053030 ~ 44056352 (-)
G710781 NA non-coding downstream 23980 44043646 ~ 44043959 (-)
G710490 NA non-coding downstream 478055 43589655 ~ 43589884 (-)
G710488 NA non-coding downstream 479677 43587684 ~ 43588262 (-)
G709835 NA non-coding downstream 547142 43520425 ~ 43520797 (-)
G710795 NA non-coding upstream 669 44068863 ~ 44069201 (-)
G710793 NA non-coding upstream 2499 44070693 ~ 44071246 (-)
G710796 NA non-coding upstream 3422 44071616 ~ 44072056 (-)
G710809 NA non-coding upstream 6564 44074758 ~ 44075236 (-)
G710817 NA non-coding upstream 17979 44086173 ~ 44086410 (-)
G709454 NA other downstream 896857 43170760 ~ 43171082 (-)
G709272 NA other downstream 1347240 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 4108326 39956961 ~ 40017167 (-)
G706683 stxbp5 other downstream 4841626 39219644 ~ 39226313 (-)
G704874 NA other downstream 5754136 38313489 ~ 38313803 (-)
G711133 NA other upstream 470599 44538793 ~ 44539504 (-)
G712814 NA other upstream 1389583 45457777 ~ 45458248 (-)
crfb16 LOC106568648 other upstream 2242936 46309732 ~ 46325685 (-)
LOC110529973 LOC106568664 other upstream 2983273 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 3110230 47178424 ~ 47178736 (-)

Expression


G710800 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G710800 Expression in each Bioproject

Bar chart with 18 bars.
G710800 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network