G710820



Basic Information


Item Value
gene id G710820
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 44088363 ~ 44088689 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU808239
cgtcggtagccctgccccccggtacacagtgtatgatcgctggatgattcgttttaagtctaatactgcgggtaatggagtcgccaatgactagagttttcaatttgtcagagctaatggtgggaagcttcggcgtctcagaccccgtaagagcgacaccggttgagcgttcctacagcatttccttccagaaaccgtgagaaagttgtccagctgcggggactgtgccaggggat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU808239 True 236 lncRNA 0.53 2 44088363 44088689

Neighbor


gene id symbol gene type direction distance location
LOC118965613 NA coding downstream 325045 43759329 ~ 43763318 (-)
mycb myc coding downstream 486058 43599754 ~ 43602305 (-)
puf60a puf60 coding downstream 1561777 42431791 ~ 42526586 (-)
klhl18 klhl18 coding downstream 1668276 42340682 ~ 42420087 (-)
LOC118965611 NA coding downstream 2359376 41725469 ~ 41728987 (-)
efr3a efr3a coding upstream 96304 44184993 ~ 44436559 (-)
LOC110529930 NA coding upstream 302189 44390878 ~ 44394639 (-)
LOC110529115 NA coding upstream 892280 44980969 ~ 44984268 (-)
basp1 NA coding upstream 1033394 45122083 ~ 45173741 (-)
znf622 znf622 coding upstream 1396329 45485018 ~ 45495101 (-)
G710819 NA non-coding downstream 502 44087661 ~ 44087861 (-)
G710817 NA non-coding downstream 1953 44086173 ~ 44086410 (-)
G710809 NA non-coding downstream 13127 44074758 ~ 44075236 (-)
G710796 NA non-coding downstream 16307 44071616 ~ 44072056 (-)
G710793 NA non-coding downstream 17117 44070693 ~ 44071246 (-)
G710822 NA non-coding upstream 5326 44094015 ~ 44095958 (-)
G711007 LOC106584485 non-coding upstream 349216 44437905 ~ 44438369 (-)
G711107 NA non-coding upstream 433305 44521994 ~ 44522225 (-)
G711121 NA non-coding upstream 443276 44531965 ~ 44532192 (-)
G711131 NA non-coding upstream 449136 44537825 ~ 44538121 (-)
G709454 NA other downstream 917281 43170760 ~ 43171082 (-)
G709272 NA other downstream 1367664 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 4128750 39956961 ~ 40017167 (-)
G706683 stxbp5 other downstream 4862050 39219644 ~ 39226313 (-)
G704874 NA other downstream 5774560 38313489 ~ 38313803 (-)
G711133 NA other upstream 450104 44538793 ~ 44539504 (-)
G712814 NA other upstream 1369088 45457777 ~ 45458248 (-)
crfb16 LOC106568648 other upstream 2222441 46309732 ~ 46325685 (-)
LOC110529973 LOC106568664 other upstream 2962778 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 3089735 47178424 ~ 47178736 (-)

Expression


G710820 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G710820 Expression in each Bioproject

Bar chart with 12 bars.
G710820 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network