G711007 (LOC106584485)



Basic Information


Item Value
gene id G711007
gene name LOC106584485
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 44437905 ~ 44438369 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU808437
cacgctgaagtcaaagtatgatgctgtgggcgccgcacagtttccacggttcatccctgacacaatgcctcagctccgcacccaagctgctcagatgctctccatgttcggcagcacttatctatgcgagcaacttttctcctcgatgaagatgaccaaaacaactcacaggagacgtctgactgatgaacatcttcgctcgatactaaggatttcttcagctcacagcttgagcccagacattgatgaactagcatccaagaagagatgccaggtatctggcttgggcacatcagattagaccagtgtgcaataattaacgttttctttatgcactttttcttgctacaaggcatgggcttgaatggttgattgatttattatcattttatttgtaaaatgattagccagtggaaaaagtttattttggtatttaaatcagaaggctgcaaatagaaaagaggc

Function


NR:

description
PREDICTED: general transcription factor II-I repeat domain-containing protein 2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU808437 True 465 lncRNA 0.43 1 44437905 44438369
Loading

Neighbor


gene id symbol gene type direction distance location
efr3a efr3a coding downstream 1346 44184993 ~ 44436559 (-)
LOC110529930 NA coding downstream 43266 44390878 ~ 44394639 (-)
LOC118965613 NA coding downstream 674587 43759329 ~ 43763318 (-)
mycb myc coding downstream 835600 43599754 ~ 43602305 (-)
puf60a puf60 coding downstream 1911319 42431791 ~ 42526586 (-)
LOC110529115 NA coding upstream 542600 44980969 ~ 44984268 (-)
basp1 NA coding upstream 683714 45122083 ~ 45173741 (-)
znf622 znf622 coding upstream 1046649 45485018 ~ 45495101 (-)
retreg1 fam134b coding upstream 1070712 45509081 ~ 45601564 (-)
nol7 nol7 coding upstream 1240490 45678859 ~ 45684992 (-)
G710822 NA non-coding downstream 341947 44094015 ~ 44095958 (-)
G710820 NA non-coding downstream 349216 44088363 ~ 44088689 (-)
G710819 NA non-coding downstream 350044 44087661 ~ 44087861 (-)
G710817 NA non-coding downstream 351495 44086173 ~ 44086410 (-)
G710809 NA non-coding downstream 362669 44074758 ~ 44075236 (-)
G711107 NA non-coding upstream 83625 44521994 ~ 44522225 (-)
G711121 NA non-coding upstream 93596 44531965 ~ 44532192 (-)
G711131 NA non-coding upstream 99456 44537825 ~ 44538121 (-)
G712181 NA non-coding upstream 111900 44550269 ~ 44629270 (-)
G712194 NA non-coding upstream 126073 44564442 ~ 44609392 (-)
G709454 NA other downstream 1266823 43170760 ~ 43171082 (-)
G709272 NA other downstream 1717206 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 4478292 39956961 ~ 40017167 (-)
G706683 stxbp5 other downstream 5211592 39219644 ~ 39226313 (-)
G704874 NA other downstream 6124102 38313489 ~ 38313803 (-)
G711133 NA other upstream 100424 44538793 ~ 44539504 (-)
G712814 NA other upstream 1019408 45457777 ~ 45458248 (-)
crfb16 LOC106568648 other upstream 1872761 46309732 ~ 46325685 (-)
LOC110529973 LOC106568664 other upstream 2613098 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 2740055 47178424 ~ 47178736 (-)

Expression


G711007(LOC106584485) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G711007(LOC106584485) Expression in each Bioproject

Bar chart with 19 bars.
G711007(LOC106584485) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network