G712181



Basic Information


Item Value
gene id G712181
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 44550269 ~ 44629270 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU809677
cgacgcaggacaccaggcggacacttggaaaatgtagtctcttatggtcaatcttccaatgatatgcctacaaatacgtcacaatgctgctaagaccttgggcgaacgacagaaagtgtaggctcattcgttgcgcaatcacagccatataaggagagaatggaaaacagagcttcagaaattctgctaattcctgggtgatgcatcatcttggtttcgcctgtagaatgagttctggggcacttacagacaaaatctttgcagattctgaaacttcagagtgttttctttccaaaactgtcaagaatatgcatagtcgagcatcttttcgtgacaaaatatcgcgcttaaaacgggaacgttttttatccaaaaatgaaatagcgcccctagagctctaacaggttaattaacaataccactgaaaata

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU809677 True 430 lncRNA 0.42 2 44550269 44629270
Loading

Neighbor


gene id symbol gene type direction distance location
efr3a efr3a coding downstream 113710 44184993 ~ 44436559 (-)
LOC110529930 NA coding downstream 155630 44390878 ~ 44394639 (-)
LOC118965613 NA coding downstream 786951 43759329 ~ 43763318 (-)
mycb myc coding downstream 947964 43599754 ~ 43602305 (-)
puf60a puf60 coding downstream 2023683 42431791 ~ 42526586 (-)
LOC110529115 NA coding upstream 351699 44980969 ~ 44984268 (-)
basp1 NA coding upstream 492813 45122083 ~ 45173741 (-)
znf622 znf622 coding upstream 855748 45485018 ~ 45495101 (-)
retreg1 fam134b coding upstream 879811 45509081 ~ 45601564 (-)
nol7 nol7 coding upstream 1049589 45678859 ~ 45684992 (-)
G711131 NA non-coding downstream 12148 44537825 ~ 44538121 (-)
G711121 NA non-coding downstream 18077 44531965 ~ 44532192 (-)
G711107 NA non-coding downstream 28044 44521994 ~ 44522225 (-)
G711007 LOC106584485 non-coding downstream 111900 44437905 ~ 44438369 (-)
G710822 NA non-coding downstream 454311 44094015 ~ 44095958 (-)
G712421 NA non-coding upstream 349703 44978973 ~ 44979408 (-)
G712622 NA non-coding upstream 594949 45224219 ~ 45224544 (-)
G712787 NA non-coding upstream 791901 45421171 ~ 45421678 (-)
G712788 NA non-coding upstream 792679 45421949 ~ 45422344 (-)
G712789 NA non-coding upstream 795110 45424380 ~ 45424611 (-)
G711133 NA other downstream 10765 44538793 ~ 44539504 (-)
G709454 NA other downstream 1379187 43170760 ~ 43171082 (-)
G709272 NA other downstream 1829570 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 4590656 39956961 ~ 40017167 (-)
G706683 stxbp5 other downstream 5323956 39219644 ~ 39226313 (-)
G712814 NA other upstream 828507 45457777 ~ 45458248 (-)
crfb16 LOC106568648 other upstream 1681860 46309732 ~ 46325685 (-)
LOC110529973 LOC106568664 other upstream 2422197 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 2549154 47178424 ~ 47178736 (-)
G715865 NA other upstream 3659672 48288942 ~ 48289581 (-)

Expression


G712181 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G712181 Expression in each Bioproject

Bar chart with 19 bars.
G712181 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network