G712210



Basic Information


Item Value
gene id G712210
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 44585333 ~ 44589776 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU809709
gttatgtgaactaggtccgtgcacgtaaaactgcgggacaagatatctctgactcattaaaactgtcttttgttacaactgaaatccactctgtccagcgtccgtgatttggtctcaactctccagtttttgaacactaacagaattggtagcagagtttggttgttcttgaattcgatctattataagttagtgtgagaggacgagactgatcacggctaaaaa

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU809709 True 225 lncRNA 0.41 2 44585333 44589776
Loading

Neighbor


gene id symbol gene type direction distance location
efr3a efr3a coding downstream 148774 44184993 ~ 44436559 (-)
LOC110529930 NA coding downstream 190694 44390878 ~ 44394639 (-)
LOC118965613 NA coding downstream 822015 43759329 ~ 43763318 (-)
mycb myc coding downstream 983028 43599754 ~ 43602305 (-)
puf60a puf60 coding downstream 2058747 42431791 ~ 42526586 (-)
LOC110529115 NA coding upstream 391193 44980969 ~ 44984268 (-)
basp1 NA coding upstream 532307 45122083 ~ 45173741 (-)
znf622 znf622 coding upstream 895242 45485018 ~ 45495101 (-)
retreg1 fam134b coding upstream 919305 45509081 ~ 45601564 (-)
nol7 nol7 coding upstream 1089083 45678859 ~ 45684992 (-)
G711131 NA non-coding downstream 47212 44537825 ~ 44538121 (-)
G711121 NA non-coding downstream 53141 44531965 ~ 44532192 (-)
G711107 NA non-coding downstream 63108 44521994 ~ 44522225 (-)
G711007 LOC106584485 non-coding downstream 146964 44437905 ~ 44438369 (-)
G710822 NA non-coding downstream 489375 44094015 ~ 44095958 (-)
G712421 NA non-coding upstream 389197 44978973 ~ 44979408 (-)
G712622 NA non-coding upstream 634443 45224219 ~ 45224544 (-)
G712787 NA non-coding upstream 831395 45421171 ~ 45421678 (-)
G712788 NA non-coding upstream 832173 45421949 ~ 45422344 (-)
G712789 NA non-coding upstream 834604 45424380 ~ 45424611 (-)
G711133 NA other downstream 45829 44538793 ~ 44539504 (-)
G709454 NA other downstream 1414251 43170760 ~ 43171082 (-)
G709272 NA other downstream 1864634 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 4625720 39956961 ~ 40017167 (-)
G706683 stxbp5 other downstream 5359020 39219644 ~ 39226313 (-)
G712814 NA other upstream 868001 45457777 ~ 45458248 (-)
crfb16 LOC106568648 other upstream 1721354 46309732 ~ 46325685 (-)
LOC110529973 LOC106568664 other upstream 2461691 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 2588648 47178424 ~ 47178736 (-)
G715865 NA other upstream 3699166 48288942 ~ 48289581 (-)

Expression


G712210 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G712210 Expression in each Bioproject

Bar chart with 13 bars.
G712210 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network