G712213



Basic Information


Item Value
gene id G712213
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 44589551 ~ 44593995 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU809713
gttatgtgaactaggtccgtgcacgtaaaactgcgggacaagatatctctgactcattaaaactgtcttttgttacaactgaaatccactctgtccagcgtccgtgatttggtctcaactctccagtttttgaacactaacagaattggtagcagagtttggttgttcttgaattcgatctattataagttagtgtgagaggacgagactgatcacggctaaaaa

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU809713 True 225 lncRNA 0.41 2 44589551 44593995
Loading

Neighbor


gene id symbol gene type direction distance location
efr3a efr3a coding downstream 152992 44184993 ~ 44436559 (-)
LOC110529930 NA coding downstream 194912 44390878 ~ 44394639 (-)
LOC118965613 NA coding downstream 826233 43759329 ~ 43763318 (-)
mycb myc coding downstream 987246 43599754 ~ 43602305 (-)
puf60a puf60 coding downstream 2062965 42431791 ~ 42526586 (-)
LOC110529115 NA coding upstream 386974 44980969 ~ 44984268 (-)
basp1 NA coding upstream 528088 45122083 ~ 45173741 (-)
znf622 znf622 coding upstream 891023 45485018 ~ 45495101 (-)
retreg1 fam134b coding upstream 915086 45509081 ~ 45601564 (-)
nol7 nol7 coding upstream 1084864 45678859 ~ 45684992 (-)
G711131 NA non-coding downstream 51430 44537825 ~ 44538121 (-)
G711121 NA non-coding downstream 57359 44531965 ~ 44532192 (-)
G711107 NA non-coding downstream 67326 44521994 ~ 44522225 (-)
G711007 LOC106584485 non-coding downstream 151182 44437905 ~ 44438369 (-)
G710822 NA non-coding downstream 493593 44094015 ~ 44095958 (-)
G712421 NA non-coding upstream 384978 44978973 ~ 44979408 (-)
G712622 NA non-coding upstream 630224 45224219 ~ 45224544 (-)
G712787 NA non-coding upstream 827176 45421171 ~ 45421678 (-)
G712788 NA non-coding upstream 827954 45421949 ~ 45422344 (-)
G712789 NA non-coding upstream 830385 45424380 ~ 45424611 (-)
G711133 NA other downstream 50047 44538793 ~ 44539504 (-)
G709454 NA other downstream 1418469 43170760 ~ 43171082 (-)
G709272 NA other downstream 1868852 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 4629938 39956961 ~ 40017167 (-)
G706683 stxbp5 other downstream 5363238 39219644 ~ 39226313 (-)
G712814 NA other upstream 863782 45457777 ~ 45458248 (-)
crfb16 LOC106568648 other upstream 1717135 46309732 ~ 46325685 (-)
LOC110529973 LOC106568664 other upstream 2457472 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 2584429 47178424 ~ 47178736 (-)
G715865 NA other upstream 3694947 48288942 ~ 48289581 (-)

Expression


G712213 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network