G712421



Basic Information


Item Value
gene id G712421
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 44978973 ~ 44979408 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU809935
tagcgtttcaatcagtgacgtcacttgctctgagaccttgaagtagtagttccccttgctctgcaagagccgcggcttttgtggagcgatgggtaacgatgcttcgagggtgactgttgatgtgtgcagaaggtccctggttcgcgcccgggtatgggcgaggggacggtctaaatttgtactgttacattgatgctgttgacccggattactggttgctgcggaaaaaggaggaaggtcaaaaggggggtgactgttgatgtgtgcagaaggtccc

Function


NR:

description
PREDICTED: U3 small nucleolar ribonucleoprotein protein IMP4-like isoform X1

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU809935 True 277 lncRNA 0.53 2 44978973 44979408
Loading

Neighbor


gene id symbol gene type direction distance location
efr3a efr3a coding downstream 542414 44184993 ~ 44436559 (-)
LOC110529930 NA coding downstream 584334 44390878 ~ 44394639 (-)
LOC118965613 NA coding downstream 1215655 43759329 ~ 43763318 (-)
mycb myc coding downstream 1376668 43599754 ~ 43602305 (-)
puf60a puf60 coding downstream 2452387 42431791 ~ 42526586 (-)
LOC110529115 NA coding upstream 1561 44980969 ~ 44984268 (-)
basp1 NA coding upstream 142675 45122083 ~ 45173741 (-)
znf622 znf622 coding upstream 505610 45485018 ~ 45495101 (-)
retreg1 fam134b coding upstream 529673 45509081 ~ 45601564 (-)
nol7 nol7 coding upstream 699451 45678859 ~ 45684992 (-)
G712181 NA non-coding downstream 349703 44550269 ~ 44629270 (-)
G712194 NA non-coding downstream 369581 44564442 ~ 44609392 (-)
G712213 NA non-coding downstream 384978 44589551 ~ 44593995 (-)
G712212 NA non-coding downstream 385579 44588373 ~ 44593394 (-)
G712208 NA non-coding downstream 386678 44583735 ~ 44592295 (-)
G712622 NA non-coding upstream 244811 45224219 ~ 45224544 (-)
G712787 NA non-coding upstream 441763 45421171 ~ 45421678 (-)
G712788 NA non-coding upstream 442541 45421949 ~ 45422344 (-)
G712789 NA non-coding upstream 444972 45424380 ~ 45424611 (-)
G712794 myo10 non-coding upstream 451365 45430773 ~ 45430996 (-)
G711133 NA other downstream 439469 44538793 ~ 44539504 (-)
G709454 NA other downstream 1807891 43170760 ~ 43171082 (-)
G709272 NA other downstream 2258274 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 5019360 39956961 ~ 40017167 (-)
G706683 stxbp5 other downstream 5752660 39219644 ~ 39226313 (-)
G712814 NA other upstream 478369 45457777 ~ 45458248 (-)
crfb16 LOC106568648 other upstream 1331722 46309732 ~ 46325685 (-)
LOC110529973 LOC106568664 other upstream 2072059 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 2199016 47178424 ~ 47178736 (-)
G715865 NA other upstream 3309534 48288942 ~ 48289581 (-)

Expression


G712421 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G712421 Expression in each Bioproject

Bar chart with 17 bars.
G712421 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network