G712794 (myo10)



Basic Information


Item Value
gene id G712794
gene name myo10
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 45430773 ~ 45430996 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU810318
TGCATGCATGTCCAGCATGCCCTTCATCTTGTCCTCGCCGTCTTTCTCGAAGTACATGAGCTTGCTCTGGCGCAGGACGAACCAGCGGCGCTTCCAGTTGCGGCGTGACAGCGTTGAGGAGCCCCCACCCTTCTTGTGGAGCCAGCCCTGCTTCAGGGCCTCCTGCTTAGCGCGGAACCACAGGAAGGTCTCGTCCTTCAGCACGCACCAACGCCGCTTCCACG

Function


symbol description
myo10 Predicted to enable ATP binding activity; actin binding activity; and cytoskeletal motor activity. Predicted to act upstream of or within signal transduction. Predicted to be located in cytoplasm and cytoskeleton. Predicted to be part of myosin complex. Is expressed in midbrain hindbrain boundary; otic vesicle; and rhombomere. Orthologous to human MYO10 (myosin X).

NR:

description
unconventional myosin-X

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU810318 True 224 lncRNA 0.62 1 45430773 45430996
Loading

Neighbor


gene id symbol gene type direction distance location
basp1 NA coding downstream 257032 45122083 ~ 45173741 (-)
LOC110529115 NA coding downstream 446505 44980969 ~ 44984268 (-)
efr3a efr3a coding downstream 994214 44184993 ~ 44436559 (-)
LOC110529930 NA coding downstream 1036134 44390878 ~ 44394639 (-)
LOC118965613 NA coding downstream 1667455 43759329 ~ 43763318 (-)
znf622 znf622 coding upstream 54022 45485018 ~ 45495101 (-)
retreg1 fam134b coding upstream 78085 45509081 ~ 45601564 (-)
nol7 nol7 coding upstream 247863 45678859 ~ 45684992 (-)
amph amph coding upstream 362252 45793248 ~ 45924730 (-)
tmem71 tmem71 coding upstream 575415 46006411 ~ 46033000 (-)
G712789 NA non-coding downstream 6162 45424380 ~ 45424611 (-)
G712788 NA non-coding downstream 8429 45421949 ~ 45422344 (-)
G712787 NA non-coding downstream 9095 45421171 ~ 45421678 (-)
G712622 NA non-coding downstream 206229 45224219 ~ 45224544 (-)
G712421 NA non-coding downstream 451365 44978973 ~ 44979408 (-)
G712803 myo10 non-coding upstream 14213 45445209 ~ 45445543 (-)
G712804 NA non-coding upstream 16273 45447269 ~ 45447502 (-)
G712806 NA non-coding upstream 18599 45449595 ~ 45449861 (-)
G712809 NA non-coding upstream 21212 45452208 ~ 45452434 (-)
G712810 myo10 non-coding upstream 22036 45453032 ~ 45453316 (-)
G711133 NA other downstream 891269 44538793 ~ 44539504 (-)
G709454 NA other downstream 2259691 43170760 ~ 43171082 (-)
G709272 NA other downstream 2710074 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 5471160 39956961 ~ 40017167 (-)
G706683 stxbp5 other downstream 6204460 39219644 ~ 39226313 (-)
G712814 NA other upstream 26781 45457777 ~ 45458248 (-)
crfb16 LOC106568648 other upstream 880134 46309732 ~ 46325685 (-)
LOC110529973 LOC106568664 other upstream 1620471 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 1747428 47178424 ~ 47178736 (-)
G715865 NA other upstream 2857946 48288942 ~ 48289581 (-)

Expression


G712794(myo10) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

G712794(myo10) Expression in each Bioproject

Bar chart with 3 bars.
G712794(myo10) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.

Co-expression Network