G712810 (myo10)



Basic Information


Item Value
gene id G712810
gene name myo10
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 45453032 ~ 45453316 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU810334
AAGTGGAACTTGAGGTATTTGAGGATTCCGCGCGATGGCATGAACGTGCAGCACATGCATGCCAGGATCCTCCAGCTGCACAGGTTCCCAGGGCTGCAGGGCTGTGGGGGACGAGTGGTCTGTTTGACCAGCTGGCAGTAGAGCTCATCCCTCAGGGGCCTCAGCTCCTGGCCCGTCTGCAGCACACCCTGGATGATGGTCACGGGGTCGGTAACACCCTCCAGGTGCTGCAGCAAGTTGAACATCTTGAGCGCCTCGTCCTGGAGTGTCGTGTAGCCCTTGTTC

Function


symbol description
myo10 Predicted to enable ATP binding activity; actin binding activity; and cytoskeletal motor activity. Predicted to act upstream of or within signal transduction. Predicted to be located in cytoplasm and cytoskeleton. Predicted to be part of myosin complex. Is expressed in midbrain hindbrain boundary; otic vesicle; and rhombomere. Orthologous to human MYO10 (myosin X).

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU810334 True 285 lncRNA 0.60 1 45453032 45453316
Loading

Neighbor


gene id symbol gene type direction distance location
basp1 NA coding downstream 279291 45122083 ~ 45173741 (-)
LOC110529115 NA coding downstream 468764 44980969 ~ 44984268 (-)
efr3a efr3a coding downstream 1016473 44184993 ~ 44436559 (-)
LOC110529930 NA coding downstream 1058393 44390878 ~ 44394639 (-)
LOC118965613 NA coding downstream 1689714 43759329 ~ 43763318 (-)
znf622 znf622 coding upstream 31702 45485018 ~ 45495101 (-)
retreg1 fam134b coding upstream 55765 45509081 ~ 45601564 (-)
nol7 nol7 coding upstream 225543 45678859 ~ 45684992 (-)
amph amph coding upstream 339932 45793248 ~ 45924730 (-)
tmem71 tmem71 coding upstream 553095 46006411 ~ 46033000 (-)
G712809 NA non-coding downstream 598 45452208 ~ 45452434 (-)
G712806 NA non-coding downstream 3171 45449595 ~ 45449861 (-)
G712804 NA non-coding downstream 5530 45447269 ~ 45447502 (-)
G712803 myo10 non-coding downstream 7489 45445209 ~ 45445543 (-)
G712794 myo10 non-coding downstream 22036 45430773 ~ 45430996 (-)
G712812 myo10 non-coding upstream 2593 45455909 ~ 45456527 (-)
G712815 NA non-coding upstream 5817 45459133 ~ 45462621 (-)
G712949 NA non-coding upstream 203860 45657176 ~ 45711563 (-)
G712967 NA non-coding upstream 258779 45712095 ~ 45712403 (-)
G712968 NA non-coding upstream 259300 45712616 ~ 45712839 (-)
G711133 NA other downstream 913528 44538793 ~ 44539504 (-)
G709454 NA other downstream 2281950 43170760 ~ 43171082 (-)
G709272 NA other downstream 2732333 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 5493419 39956961 ~ 40017167 (-)
G706683 stxbp5 other downstream 6226719 39219644 ~ 39226313 (-)
G712814 NA other upstream 4461 45457777 ~ 45458248 (-)
crfb16 LOC106568648 other upstream 857814 46309732 ~ 46325685 (-)
LOC110529973 LOC106568664 other upstream 1598151 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 1725108 47178424 ~ 47178736 (-)
G715865 NA other upstream 2835626 48288942 ~ 48289581 (-)

Expression


G712810(myo10) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G712810(myo10) Expression in each Bioproject

Bar chart with 4 bars.
G712810(myo10) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network