G712814



Basic Information


Item Value
gene id G712814
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 45457777 ~ 45458248 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU810338
GTGGATCCGTAGCCGGGCCACTCTTTGACCAGGGCCATGTACTTCACCATGGCCAGCTCCTGGTTCATCCCCTGCAGCTTCTTCCACTTGTCCACCAGGCTGGCTCGTGCTGCCGCTATCTCCTCCCTCATCCAGGCCTCGAGCGTGTTCTCCTCCTCCAACTTCTGGCGGCTCATTGAGCCGCTCCTGAAACTACGCCTTAGCGTTCCCTCCAAGAAGCTGGAGCGCTTCTTCTCCAAGGTTCCATCGGAACGGTCCACCACTGACCCCATGCCCAAACCAGTGGCCGGGGAGAAAGTCTTGGCGGAATTTTGGATGCGGGCACGCAACCGAGTCATAGGGAACACCTGAGACATTTCGGGCACGGTAGCTTGGGGGTTGTAGTCTCCGAGGAGGTATTGTAGTCTTAGGGCAGCCAGGAACTGGAGGGTCTCCTCCGGAGCTGGGTAATGGCCTCTGATCACCGCCTCAT

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU810338 True 472 TUCP 0.59 1 45457777 45458248
Loading

Neighbor


gene id symbol gene type direction distance location
basp1 NA coding downstream 284036 45122083 ~ 45173741 (-)
LOC110529115 NA coding downstream 473509 44980969 ~ 44984268 (-)
efr3a efr3a coding downstream 1021218 44184993 ~ 44436559 (-)
LOC110529930 NA coding downstream 1063138 44390878 ~ 44394639 (-)
LOC118965613 NA coding downstream 1694459 43759329 ~ 43763318 (-)
znf622 znf622 coding upstream 26770 45485018 ~ 45495101 (-)
retreg1 fam134b coding upstream 50833 45509081 ~ 45601564 (-)
nol7 nol7 coding upstream 220611 45678859 ~ 45684992 (-)
amph amph coding upstream 335000 45793248 ~ 45924730 (-)
tmem71 tmem71 coding upstream 548163 46006411 ~ 46033000 (-)
G712812 myo10 non-coding downstream 1250 45455909 ~ 45456527 (-)
G712810 myo10 non-coding downstream 4461 45453032 ~ 45453316 (-)
G712809 NA non-coding downstream 5343 45452208 ~ 45452434 (-)
G712806 NA non-coding downstream 7916 45449595 ~ 45449861 (-)
G712804 NA non-coding downstream 10275 45447269 ~ 45447502 (-)
G712815 NA non-coding upstream 885 45459133 ~ 45462621 (-)
G712949 NA non-coding upstream 198928 45657176 ~ 45711563 (-)
G712967 NA non-coding upstream 253847 45712095 ~ 45712403 (-)
G712968 NA non-coding upstream 254368 45712616 ~ 45712839 (-)
G712969 NA non-coding upstream 255298 45713546 ~ 45713820 (-)
G711133 NA other downstream 918273 44538793 ~ 44539504 (-)
G709454 NA other downstream 2286695 43170760 ~ 43171082 (-)
G709272 NA other downstream 2737078 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 5498164 39956961 ~ 40017167 (-)
G706683 stxbp5 other downstream 6231464 39219644 ~ 39226313 (-)
crfb16 LOC106568648 other upstream 852882 46309732 ~ 46325685 (-)
LOC110529973 LOC106568664 other upstream 1593219 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 1720176 47178424 ~ 47178736 (-)
G715865 NA other upstream 2830694 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 3084043 48356004 ~ 48616588 (-)

Expression


G712814 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G712814 Expression in each Bioproject

Bar chart with 9 bars.
G712814 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network