G712968



Basic Information


Item Value
gene id G712968
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 45712616 ~ 45712839 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU810502
tgtttggaggaagaagaaggatgagtacaaccccaagaacaccatcccaaccgtgaagcatggaggtggaaacatcattatttggggatgcttttctgcaaaggggacaggacgactgcaccgtattgaggggaggatggatggggccatgtatcgcaagatcttggccaacaacctccttccctcagtaagagcattgaagatgggtcgtggctgggtcttcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU810502 True 224 lncRNA 0.51 1 45712616 45712839
Loading

Neighbor


gene id symbol gene type direction distance location
nol7 nol7 coding downstream 27624 45678859 ~ 45684992 (-)
retreg1 fam134b coding downstream 111052 45509081 ~ 45601564 (-)
znf622 znf622 coding downstream 217515 45485018 ~ 45495101 (-)
basp1 NA coding downstream 538875 45122083 ~ 45173741 (-)
LOC110529115 NA coding downstream 728348 44980969 ~ 44984268 (-)
amph amph coding upstream 80409 45793248 ~ 45924730 (-)
tmem71 tmem71 coding upstream 293572 46006411 ~ 46033000 (-)
ift57 ift57 coding upstream 348904 46061743 ~ 46074046 (-)
cavin4a LOC106568643 coding upstream 409905 46122744 ~ 46133988 (-)
tmeff1a tmeff1 coding upstream 450814 46163653 ~ 46241437 (-)
G712967 NA non-coding downstream 213 45712095 ~ 45712403 (-)
G712949 NA non-coding downstream 1053 45657176 ~ 45711563 (-)
G712815 NA non-coding downstream 249995 45459133 ~ 45462621 (-)
G712812 myo10 non-coding downstream 256089 45455909 ~ 45456527 (-)
G712810 myo10 non-coding downstream 259300 45453032 ~ 45453316 (-)
G712969 NA non-coding upstream 707 45713546 ~ 45713820 (-)
G712972 NA non-coding upstream 4826 45717665 ~ 45717876 (-)
G712973 NA non-coding upstream 5443 45718282 ~ 45718499 (-)
G712998 NA non-coding upstream 50828 45763667 ~ 45767088 (-)
G713002 NA non-coding upstream 59290 45772129 ~ 45772379 (-)
G712814 NA other downstream 254368 45457777 ~ 45458248 (-)
G711133 NA other downstream 1173112 44538793 ~ 44539504 (-)
G709454 NA other downstream 2541534 43170760 ~ 43171082 (-)
G709272 NA other downstream 2991917 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 5753003 39956961 ~ 40017167 (-)
crfb16 LOC106568648 other upstream 598291 46309732 ~ 46325685 (-)
LOC110529973 LOC106568664 other upstream 1338628 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 1465585 47178424 ~ 47178736 (-)
G715865 NA other upstream 2576103 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 2829452 48356004 ~ 48616588 (-)

Expression


G712968 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G712968 Expression in each Bioproject

Bar chart with 21 bars.
G712968 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network