G712973



Basic Information


Item Value
gene id G712973
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 45718282 ~ 45718499 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU810507
gtctacctgggagtctcgtgagtgaaaacatccgaagttcatcaaaggtaaacgatttaatttgattgcttttctgatttccgtgacaaggttgcctgctgctagcaaggcataatgctatgctaggctatgataaacttacacaaatgcttgtctagcgttggctgtaaagcataatttgaaaatctgagatgacagggtgaaaggctaagctgtgt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU810507 True 218 lncRNA 0.41 1 45718282 45718499
Loading

Neighbor


gene id symbol gene type direction distance location
nol7 nol7 coding downstream 33290 45678859 ~ 45684992 (-)
retreg1 fam134b coding downstream 116718 45509081 ~ 45601564 (-)
znf622 znf622 coding downstream 223181 45485018 ~ 45495101 (-)
basp1 NA coding downstream 544541 45122083 ~ 45173741 (-)
LOC110529115 NA coding downstream 734014 44980969 ~ 44984268 (-)
amph amph coding upstream 74749 45793248 ~ 45924730 (-)
tmem71 tmem71 coding upstream 287912 46006411 ~ 46033000 (-)
ift57 ift57 coding upstream 343244 46061743 ~ 46074046 (-)
cavin4a LOC106568643 coding upstream 404245 46122744 ~ 46133988 (-)
tmeff1a tmeff1 coding upstream 445154 46163653 ~ 46241437 (-)
G712972 NA non-coding downstream 406 45717665 ~ 45717876 (-)
G712969 NA non-coding downstream 4462 45713546 ~ 45713820 (-)
G712968 NA non-coding downstream 5443 45712616 ~ 45712839 (-)
G712967 NA non-coding downstream 5879 45712095 ~ 45712403 (-)
G712949 NA non-coding downstream 6719 45657176 ~ 45711563 (-)
G712998 NA non-coding upstream 45168 45763667 ~ 45767088 (-)
G713002 NA non-coding upstream 53630 45772129 ~ 45772379 (-)
G713011 NA non-coding upstream 66287 45784786 ~ 45785064 (-)
G713049 NA non-coding upstream 144987 45863486 ~ 45891714 (-)
G713072 NA non-coding upstream 186686 45905185 ~ 45944390 (-)
G712814 NA other downstream 260034 45457777 ~ 45458248 (-)
G711133 NA other downstream 1178778 44538793 ~ 44539504 (-)
G709454 NA other downstream 2547200 43170760 ~ 43171082 (-)
G709272 NA other downstream 2997583 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 5758669 39956961 ~ 40017167 (-)
crfb16 LOC106568648 other upstream 592631 46309732 ~ 46325685 (-)
LOC110529973 LOC106568664 other upstream 1332968 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 1459925 47178424 ~ 47178736 (-)
G715865 NA other upstream 2570443 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 2823792 48356004 ~ 48616588 (-)

Expression


G712973 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G712973 Expression in each Bioproject

Bar chart with 19 bars.
G712973 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network