G713072



Basic Information


Item Value
gene id G713072
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 45905185 ~ 45944390 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU810619
gatttggaaaggcacacacctgtctatataaggtcccacaggtggactccaatccagttgtagaaacatatcaagaatgatcagtggaaacaggatgcacctgagctcaattttgagtctcattgcaaagggtctgaatacttgtgtaaataaaagtatatctgtttttgttatttttaatacatttgcaagaatttcctaaaacctgttttcgctttggcattatggggt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU810619 True 231 lncRNA 0.37 2 45905185 45944390
Loading

Neighbor


gene id symbol gene type direction distance location
nol7 nol7 coding downstream 220193 45678859 ~ 45684992 (-)
retreg1 fam134b coding downstream 303621 45509081 ~ 45601564 (-)
znf622 znf622 coding downstream 410084 45485018 ~ 45495101 (-)
basp1 NA coding downstream 731444 45122083 ~ 45173741 (-)
LOC110529115 NA coding downstream 920917 44980969 ~ 44984268 (-)
tmem71 tmem71 coding upstream 62021 46006411 ~ 46033000 (-)
ift57 ift57 coding upstream 117353 46061743 ~ 46074046 (-)
cavin4a LOC106568643 coding upstream 178354 46122744 ~ 46133988 (-)
tmeff1a tmeff1 coding upstream 219263 46163653 ~ 46241437 (-)
crfb16 LOC106568648 coding upstream 365342 46309732 ~ 46325685 (-)
G713049 NA non-coding downstream 13471 45863486 ~ 45891714 (-)
G713011 NA non-coding downstream 120121 45784786 ~ 45785064 (-)
G713002 NA non-coding downstream 132806 45772129 ~ 45772379 (-)
G712998 NA non-coding downstream 138097 45763667 ~ 45767088 (-)
G712973 NA non-coding downstream 186686 45718282 ~ 45718499 (-)
G713114 NA non-coding upstream 10481 45954871 ~ 45955074 (-)
G713141 NA non-coding upstream 46553 45990943 ~ 45991219 (-)
G713142 NA non-coding upstream 47425 45991815 ~ 45992105 (-)
G713150 NA non-coding upstream 57769 46002159 ~ 46002461 (-)
G713164 NA non-coding upstream 92856 46037246 ~ 46037460 (-)
G712814 NA other downstream 446937 45457777 ~ 45458248 (-)
G711133 NA other downstream 1365681 44538793 ~ 44539504 (-)
G709454 NA other downstream 2734103 43170760 ~ 43171082 (-)
G709272 NA other downstream 3184486 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 5945572 39956961 ~ 40017167 (-)
LOC110529973 LOC106568664 other upstream 1107077 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 1234034 47178424 ~ 47178736 (-)
G715865 NA other upstream 2344552 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 2597901 48356004 ~ 48616588 (-)

Expression


G713072 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G713072 Expression in each Bioproject

Bar chart with 11 bars.
G713072 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network