G713141



Basic Information


Item Value
gene id G713141
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 45990943 ~ 45991219 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU810691
gggtatgtctctatcagttttgcacatcgagagactgacattttttcccattcctccttgcaagacagctcgagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggaaatgtttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU810691 True 277 lncRNA 0.42 1 45990943 45991219

Neighbor


gene id symbol gene type direction distance location
amph amph coding downstream 66213 45793248 ~ 45924730 (-)
nol7 nol7 coding downstream 305951 45678859 ~ 45684992 (-)
retreg1 fam134b coding downstream 389379 45509081 ~ 45601564 (-)
znf622 znf622 coding downstream 495842 45485018 ~ 45495101 (-)
basp1 NA coding downstream 817202 45122083 ~ 45173741 (-)
tmem71 tmem71 coding upstream 15192 46006411 ~ 46033000 (-)
ift57 ift57 coding upstream 70524 46061743 ~ 46074046 (-)
cavin4a LOC106568643 coding upstream 131525 46122744 ~ 46133988 (-)
tmeff1a tmeff1 coding upstream 172434 46163653 ~ 46241437 (-)
crfb16 LOC106568648 coding upstream 318513 46309732 ~ 46325685 (-)
G713114 NA non-coding downstream 35869 45954871 ~ 45955074 (-)
G713072 NA non-coding downstream 46553 45905185 ~ 45944390 (-)
G713049 NA non-coding downstream 99229 45863486 ~ 45891714 (-)
G713011 NA non-coding downstream 205879 45784786 ~ 45785064 (-)
G713002 NA non-coding downstream 218564 45772129 ~ 45772379 (-)
G713142 NA non-coding upstream 596 45991815 ~ 45992105 (-)
G713150 NA non-coding upstream 10940 46002159 ~ 46002461 (-)
G713164 NA non-coding upstream 46027 46037246 ~ 46037460 (-)
G713201 NA non-coding upstream 125457 46116676 ~ 46119814 (-)
G713203 NA non-coding upstream 128835 46120054 ~ 46120821 (-)
G712814 NA other downstream 532695 45457777 ~ 45458248 (-)
G711133 NA other downstream 1451439 44538793 ~ 44539504 (-)
G709454 NA other downstream 2819861 43170760 ~ 43171082 (-)
G709272 NA other downstream 3270244 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 6031330 39956961 ~ 40017167 (-)
LOC110529973 LOC106568664 other upstream 1060248 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 1187205 47178424 ~ 47178736 (-)
G715865 NA other upstream 2297723 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 2551072 48356004 ~ 48616588 (-)

Expression


G713141 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G713141 Expression in each Bioproject

Bar chart with 18 bars.
G713141 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network