G713660



Basic Information


Item Value
gene id G713660
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 46254476 ~ 46339044 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU811239
atttgaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggttgttcagggtgatgagctgtgttgcttttacgccacacataacgttttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaatgacacttt

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU811239 True 242 lncRNA 0.46 2 46254476 46339044

Neighbor


gene id symbol gene type direction distance location
tmeff1a tmeff1 coding downstream 13039 46163653 ~ 46241437 (-)
cavin4a LOC106568643 coding downstream 120488 46122744 ~ 46133988 (-)
ift57 ift57 coding downstream 180430 46061743 ~ 46074046 (-)
tmem71 tmem71 coding downstream 221476 46006411 ~ 46033000 (-)
amph amph coding downstream 329746 45793248 ~ 45924730 (-)
LOC110529956 LOC106568794 coding upstream 49898 46388942 ~ 46395118 (-)
dusp28 LOC106568652 coding upstream 68689 46407733 ~ 46417579 (-)
sft2d3 sft2d3 coding upstream 123581 46462625 ~ 46463692 (-)
si:ch1073-184j22.1 LOC106568655 coding upstream 188606 46527650 ~ 46556891 (-)
pex5lb LOC106568657 coding upstream 312784 46651828 ~ 46803169 (-)
G713293 NA non-coding downstream 8047 46246065 ~ 46246429 (-)
G713287 NA non-coding downstream 12419 46241856 ~ 46242057 (-)
G713211 NA non-coding downstream 117538 46136731 ~ 46136938 (-)
G713202 NA non-coding downstream 132745 46121282 ~ 46121731 (-)
G713203 NA non-coding downstream 133655 46120054 ~ 46120821 (-)
G713694 NA non-coding upstream 15615 46354659 ~ 46424529 (-)
G713736 NA non-coding upstream 26381 46365425 ~ 46376646 (-)
G713738 NA non-coding upstream 42522 46381566 ~ 46387729 (-)
G713742 proc non-coding upstream 59972 46399016 ~ 46406912 (-)
G713766 NA non-coding upstream 121646 46460690 ~ 46462111 (-)
G712814 NA other downstream 796228 45457777 ~ 45458248 (-)
G711133 NA other downstream 1714972 44538793 ~ 44539504 (-)
G709454 NA other downstream 3083394 43170760 ~ 43171082 (-)
G709272 NA other downstream 3533777 42719771 ~ 42720699 (-)
slc22a16 LOC106571810 other downstream 6294863 39956961 ~ 40017167 (-)
LOC110529973 LOC106568664 other upstream 712423 47051073 ~ 47067973 (-)
G714425 LOC106568665 other upstream 839380 47178424 ~ 47178736 (-)
G715865 NA other upstream 1949898 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 2203247 48356004 ~ 48616588 (-)
G716463 LOC106591423 other upstream 2420868 48759912 ~ 48761163 (-)

Expression


G713660 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G713660 Expression in each Bioproject

Bar chart with 13 bars.
G713660 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network