G713774



Basic Information


Item Value
gene id G713774
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 46466616 ~ 46466827 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU811366
gacatagacatatctgtaatgggcagaaagcttaaattcttgttaatctaactgcactgtccaatttacagtagttattacagtgaaataataccatgctattgtttgaaaagagtgcacagttatgaacttgaaaagttattaataaaccaattaggcacatttgggcagtcttgaaacaaaatttttaacagaaatgcaatggttcattg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU811366 True 212 lncRNA 0.32 1 46466616 46466827
Loading

Neighbor


gene id symbol gene type direction distance location
sft2d3 sft2d3 coding downstream 2924 46462625 ~ 46463692 (-)
dusp28 LOC106568652 coding downstream 49037 46407733 ~ 46417579 (-)
LOC110529956 LOC106568794 coding downstream 71498 46388942 ~ 46395118 (-)
crfb16 LOC106568648 coding downstream 140931 46309732 ~ 46325685 (-)
tmeff1a tmeff1 coding downstream 225179 46163653 ~ 46241437 (-)
si:ch1073-184j22.1 LOC106568655 coding upstream 60823 46527650 ~ 46556891 (-)
pex5lb LOC106568657 coding upstream 185001 46651828 ~ 46803169 (-)
nebl LOC106568663 coding upstream 549058 47015885 ~ 47027075 (-)
dnajc1 dnjc1 coding upstream 560367 47027194 ~ 47035362 (-)
LOC110529973 LOC106568664 coding upstream 584246 47051073 ~ 47067973 (-)
G713773 NA non-coding downstream 423 46465622 ~ 46466193 (-)
G713772 NA non-coding downstream 1308 46464768 ~ 46465308 (-)
G713771 NA non-coding downstream 2210 46463984 ~ 46464406 (-)
G713766 NA non-coding downstream 4505 46460690 ~ 46462111 (-)
G713742 proc non-coding downstream 59704 46399016 ~ 46406912 (-)
G713775 NA non-coding upstream 815 46467642 ~ 46468423 (-)
G713776 NA non-coding upstream 1777 46468604 ~ 46469042 (-)
G713777 NA non-coding upstream 3034 46469861 ~ 46470223 (-)
G713778 NA non-coding upstream 4256 46471083 ~ 46471285 (-)
G713779 NA non-coding upstream 4651 46471478 ~ 46471681 (-)
G712814 NA other downstream 1008368 45457777 ~ 45458248 (-)
G711133 NA other downstream 1927112 44538793 ~ 44539504 (-)
G709454 NA other downstream 3295534 43170760 ~ 43171082 (-)
G709272 NA other downstream 3745917 42719771 ~ 42720699 (-)
G714425 LOC106568665 other upstream 711597 47178424 ~ 47178736 (-)
G715865 NA other upstream 1822115 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 2075464 48356004 ~ 48616588 (-)
G716463 LOC106591423 other upstream 2293085 48759912 ~ 48761163 (-)

Expression


G713774 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G713774 Expression in each Bioproject

Bar chart with 18 bars.
G713774 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network