G713786



Basic Information


Item Value
gene id G713786
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 46482596 ~ 46482817 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU811378
GCTACACGAGCTAGCTACTTCCCTCACTGTAACGTGAAAGGGGGGGCTGTTCCATTAAACAAAGTTGAAGTCTTTTTCCCTACATGGCTCTGGTACTTTCAACCCATGCAAGTGTTTGTGTGCAGGTGGTTGACATCATTCAGTGTTTGAATTTTTATTTATCTGAAAAGAGTCAAGAGCTGTTTTTCTACCACCAATGCAGTTGTCATTTTTGCCCCAGGC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU811378 True 222 lncRNA 0.43 1 46482596 46482817
Loading

Neighbor


gene id symbol gene type direction distance location
sft2d3 sft2d3 coding downstream 18904 46462625 ~ 46463692 (-)
dusp28 LOC106568652 coding downstream 65017 46407733 ~ 46417579 (-)
LOC110529956 LOC106568794 coding downstream 87478 46388942 ~ 46395118 (-)
crfb16 LOC106568648 coding downstream 156911 46309732 ~ 46325685 (-)
tmeff1a tmeff1 coding downstream 241159 46163653 ~ 46241437 (-)
si:ch1073-184j22.1 LOC106568655 coding upstream 44833 46527650 ~ 46556891 (-)
pex5lb LOC106568657 coding upstream 169011 46651828 ~ 46803169 (-)
nebl LOC106568663 coding upstream 533068 47015885 ~ 47027075 (-)
dnajc1 dnjc1 coding upstream 544377 47027194 ~ 47035362 (-)
LOC110529973 LOC106568664 coding upstream 568256 47051073 ~ 47067973 (-)
G713779 NA non-coding downstream 10915 46471478 ~ 46471681 (-)
G713778 NA non-coding downstream 11311 46471083 ~ 46471285 (-)
G713777 NA non-coding downstream 12373 46469861 ~ 46470223 (-)
G713776 NA non-coding downstream 13554 46468604 ~ 46469042 (-)
G713775 NA non-coding downstream 14173 46467642 ~ 46468423 (-)
G713794 NA non-coding upstream 8545 46491362 ~ 46491703 (-)
G713804 NA non-coding upstream 41958 46524775 ~ 46526683 (-)
G713848 NA non-coding upstream 91969 46574786 ~ 46575007 (-)
G713851 NA non-coding upstream 94474 46577291 ~ 46577500 (-)
G713869 NA non-coding upstream 111576 46594393 ~ 46595176 (-)
G712814 NA other downstream 1024348 45457777 ~ 45458248 (-)
G711133 NA other downstream 1943092 44538793 ~ 44539504 (-)
G709454 NA other downstream 3311514 43170760 ~ 43171082 (-)
G709272 NA other downstream 3761897 42719771 ~ 42720699 (-)
G714425 LOC106568665 other upstream 695607 47178424 ~ 47178736 (-)
G715865 NA other upstream 1806125 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 2059474 48356004 ~ 48616588 (-)
G716463 LOC106591423 other upstream 2277095 48759912 ~ 48761163 (-)

Expression


G713786 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G713786 Expression in each Bioproject

Bar chart with 3 bars.
G713786 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network