G713884



Basic Information


Item Value
gene id G713884
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 46626609 ~ 46627141 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU811484
agcgtaatcatagcctcaagctcattaccataacgcaatgttaactattcatgaaaatcgcaaattaaatgaaagaaatatattgactcacaagcttagccttttgttaacaacactgtcatctcagattttcaaaatatgcttttcaaccatagctacacaagcatttgtgtaagagtattgatagctagcatagcattaagcctagcattcagcaggcaacattttcacaaaaacaagaaaagcattcaaataaaatcatttacctttgaagaactttggatgttttcaatgaggagactctcagttagatagcaaatgttcagtttttccaaaaatattatttgtgtaggagaaatcgctccgttttgttcatcacgtttggctaagaaaaaaaaaacgaaaattcagtcattacaacgccaaacttttttccaaatgaactccataatatcaacagaaacatggcaaacgttgtttagaatcaatcctcaaggtgtttttcacatatctattcgatgataaatcattcg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU811484 True 533 lncRNA 0.33 1 46626609 46627141

Neighbor


gene id symbol gene type direction distance location
si:ch1073-184j22.1 LOC106568655 coding downstream 69718 46527650 ~ 46556891 (-)
sft2d3 sft2d3 coding downstream 162917 46462625 ~ 46463692 (-)
dusp28 LOC106568652 coding downstream 209030 46407733 ~ 46417579 (-)
LOC110529956 LOC106568794 coding downstream 231491 46388942 ~ 46395118 (-)
crfb16 LOC106568648 coding downstream 300924 46309732 ~ 46325685 (-)
pex5lb LOC106568657 coding upstream 24687 46651828 ~ 46803169 (-)
nebl LOC106568663 coding upstream 388744 47015885 ~ 47027075 (-)
dnajc1 dnjc1 coding upstream 400053 47027194 ~ 47035362 (-)
LOC110529973 LOC106568664 coding upstream 423932 47051073 ~ 47067973 (-)
LOC110529976 LOC106568668 coding upstream 602946 47230087 ~ 47260852 (-)
G713870 LOC106568656 non-coding downstream 19293 46596479 ~ 46607316 (-)
G713869 NA non-coding downstream 31433 46594393 ~ 46595176 (-)
G713851 NA non-coding downstream 49109 46577291 ~ 46577500 (-)
G713848 NA non-coding downstream 51602 46574786 ~ 46575007 (-)
G713804 NA non-coding downstream 99926 46524775 ~ 46526683 (-)
G713887 NA non-coding upstream 2441 46629582 ~ 46629799 (-)
G713889 NA non-coding upstream 4385 46631526 ~ 46631850 (-)
G713890 NA non-coding upstream 6221 46633362 ~ 46633615 (-)
G713891 NA non-coding upstream 8533 46635674 ~ 46635925 (-)
G713855 NA non-coding upstream 21559 46648700 ~ 46719825 (-)
G712814 NA other downstream 1168361 45457777 ~ 45458248 (-)
G711133 NA other downstream 2087105 44538793 ~ 44539504 (-)
G709454 NA other downstream 3455527 43170760 ~ 43171082 (-)
G709272 NA other downstream 3905910 42719771 ~ 42720699 (-)
G714425 LOC106568665 other upstream 551283 47178424 ~ 47178736 (-)
G715865 NA other upstream 1661801 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 1915150 48356004 ~ 48616588 (-)
G716463 LOC106591423 other upstream 2132771 48759912 ~ 48761163 (-)

Expression


G713884 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G713884 Expression in each Bioproject

Bar chart with 19 bars.
G713884 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network