G713887



Basic Information


Item Value
gene id G713887
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 46629582 ~ 46629799 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU811487
CTTCCATTCCGGTTTCAGTGAGCATACCAAAGTAAGCTGAACGAAGCCGGTGATAGTAGATTTGTGGATGTTCATTTCGAGCTTGTCTGATATTGTTAGCAAACGAGCTATCGTGTTTGCGAGTCTCAGAACCACTGAATTCTATTTTCAAAACTGTGGCAAGTTTAGCATAGTCGTTTTGCACGTGTTGCTCTTGTAGACGGATGAACCTTGTCACG

Function


NR:

description
uncharacterized protein LOC111188456

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU811487 True 218 lncRNA 0.43 1 46629582 46629799
Loading

Neighbor


gene id symbol gene type direction distance location
si:ch1073-184j22.1 LOC106568655 coding downstream 72691 46527650 ~ 46556891 (-)
sft2d3 sft2d3 coding downstream 165890 46462625 ~ 46463692 (-)
dusp28 LOC106568652 coding downstream 212003 46407733 ~ 46417579 (-)
LOC110529956 LOC106568794 coding downstream 234464 46388942 ~ 46395118 (-)
crfb16 LOC106568648 coding downstream 303897 46309732 ~ 46325685 (-)
pex5lb LOC106568657 coding upstream 22029 46651828 ~ 46803169 (-)
nebl LOC106568663 coding upstream 386086 47015885 ~ 47027075 (-)
dnajc1 dnjc1 coding upstream 397395 47027194 ~ 47035362 (-)
LOC110529973 LOC106568664 coding upstream 421274 47051073 ~ 47067973 (-)
LOC110529976 LOC106568668 coding upstream 600288 47230087 ~ 47260852 (-)
G713884 NA non-coding downstream 2441 46626609 ~ 46627141 (-)
G713870 LOC106568656 non-coding downstream 22266 46596479 ~ 46607316 (-)
G713869 NA non-coding downstream 34406 46594393 ~ 46595176 (-)
G713851 NA non-coding downstream 52082 46577291 ~ 46577500 (-)
G713848 NA non-coding downstream 54575 46574786 ~ 46575007 (-)
G713889 NA non-coding upstream 1727 46631526 ~ 46631850 (-)
G713890 NA non-coding upstream 3563 46633362 ~ 46633615 (-)
G713891 NA non-coding upstream 5875 46635674 ~ 46635925 (-)
G713855 NA non-coding upstream 18901 46648700 ~ 46719825 (-)
G713962 NA non-coding upstream 160786 46790585 ~ 46790895 (-)
G712814 NA other downstream 1171334 45457777 ~ 45458248 (-)
G711133 NA other downstream 2090078 44538793 ~ 44539504 (-)
G709454 NA other downstream 3458500 43170760 ~ 43171082 (-)
G709272 NA other downstream 3908883 42719771 ~ 42720699 (-)
G714425 LOC106568665 other upstream 548625 47178424 ~ 47178736 (-)
G715865 NA other upstream 1659143 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 1912492 48356004 ~ 48616588 (-)
G716463 LOC106591423 other upstream 2130113 48759912 ~ 48761163 (-)

Expression


G713887 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G713887 Expression in each Bioproject

Bar chart with 10 bars.
G713887 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network