G713574


Basic Information

Item Value
gene id G713574
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 46715915 ~ 46769246 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU811150
cgagatactgttatgaagaagtttaaagccggatttggatacaaaacgatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaaccttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgacctgcatcgatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagacgaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctgaacacaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgaggggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgggacggagattagtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagc

Function

NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU811150 True 862 TUCP 0.44 2 46715915 46769246
Loading

Neighbor

gene id symbol gene type direction distance location
LOC118965520 NA coding upstream 1773 46704259 ~ 46714142 (+)
mfn1a LOC106568656 coding upstream 96749 46594403 ~ 46619166 (+)
si:ch1073-184j22.2 LOC106568795 coding upstream 202757 46510102 ~ 46513158 (+)
wdr33 wdr33 coding upstream 253789 46419920 ~ 46462126 (+)
proca proc coding upstream 309010 46399019 ~ 46406905 (+)
phb2a LOC106568660 coding downstream 93315 46862561 ~ 46898724 (+)
LOC110529968 LOC106568661 coding downstream 146899 46916145 ~ 46931901 (+)
LOC110529116 LOC106597230 coding downstream 184874 46954120 ~ 46956941 (+)
LOC110529969 LOC106568662 coding downstream 208833 46978079 ~ 47004330 (+)
LOC110529974 LOC106568665 coding downstream 371411 47140657 ~ 47194560 (+)
G713514 NA non-coding upstream 60497 46636155 ~ 46655418 (+)
G713513 NA non-coding upstream 79854 46635629 ~ 46636061 (+)
G713512 NA non-coding upstream 80587 46635104 ~ 46635328 (+)
G713508 NA non-coding upstream 87790 46627913 ~ 46628125 (+)
G713504 NA non-coding upstream 90608 46624969 ~ 46625307 (+)
G713610 NA non-coding downstream 11571 46780817 ~ 46848749 (+)
G714030 NA non-coding downstream 90024 46859270 ~ 46859590 (+)
G714062 NA non-coding downstream 138184 46907430 ~ 46907812 (+)
G714103 NA non-coding downstream 192945 46962191 ~ 46962390 (+)
G714123 NA non-coding downstream 230032 46999278 ~ 47000089 (+)
G713405 NA other upstream 249688 46465398 ~ 46466227 (+)
G711912 NA other upstream 921366 45793269 ~ 45794549 (+)
G711845 NA other upstream 1068538 45646857 ~ 45647377 (+)
G711021 NA other upstream 2266942 44448584 ~ 44448973 (+)
G709490 NA other upstream 3518273 43196560 ~ 43197642 (+)
G716035 LOC106581475 other downstream 1768497 48537743 ~ 48544164 (+)
G716133 NA other downstream 1991097 48760343 ~ 48760740 (+)
G716862 NA other downstream 2563595 49332841 ~ 49333772 (+)
G716993 LOC100136012 other downstream 2776966 49546212 ~ 49547085 (+)
LOC118965615 NA other downstream 3084141 49853027 ~ 49854435 (+)

Expression

G713574 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G713574 Expression in each Bioproject

Bar chart with 20 bars.
G713574 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network