G714193



Basic Information


Item Value
gene id G714193
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 46903563 ~ 46903762 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU811801
gtgccttgcgaaagtattcggcccccttgaactttgcgaccttttgccacatttcaggcttcaaacataaagatataaaactgtatttttttgtgaagaatcaacaacaagtgggacacaatcatgaagtggaacgacatttattggatatttcaaactaacaaatcaaaaactgaaaaattgggcgtgcaaaattattc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU811801 True 200 lncRNA 0.36 1 46903563 46903762
Loading

Neighbor


gene id symbol gene type direction distance location
pex5lb LOC106568657 coding downstream 100394 46651828 ~ 46803169 (-)
si:ch1073-184j22.1 LOC106568655 coding downstream 346672 46527650 ~ 46556891 (-)
sft2d3 sft2d3 coding downstream 439871 46462625 ~ 46463692 (-)
dusp28 LOC106568652 coding downstream 485984 46407733 ~ 46417579 (-)
LOC110529956 LOC106568794 coding downstream 508445 46388942 ~ 46395118 (-)
nebl LOC106568663 coding upstream 112123 47015885 ~ 47027075 (-)
dnajc1 dnjc1 coding upstream 123432 47027194 ~ 47035362 (-)
LOC110529973 LOC106568664 coding upstream 147311 47051073 ~ 47067973 (-)
LOC110529976 LOC106568668 coding upstream 326325 47230087 ~ 47260852 (-)
LOC110529977 LOC106568669 coding upstream 379977 47283739 ~ 47295308 (-)
G714190 NA non-coding downstream 3807 46899424 ~ 46899756 (-)
G714168 NA non-coding downstream 41890 46861316 ~ 46861673 (-)
G714020 NA non-coding downstream 52465 46850703 ~ 46851098 (-)
G713962 NA non-coding downstream 112668 46790585 ~ 46790895 (-)
G713855 NA non-coding downstream 183738 46648700 ~ 46719825 (-)
G714200 NA non-coding upstream 10502 46914264 ~ 46951738 (-)
G714232 LOC106576489 non-coding upstream 60014 46963776 ~ 46964049 (-)
G714235 NA non-coding upstream 65440 46969202 ~ 46969837 (-)
G714236 NA non-coding upstream 66119 46969881 ~ 46973069 (-)
G714240 NA non-coding upstream 70283 46974045 ~ 46974336 (-)
crfb16 LOC106568648 other downstream 577882 46309732 ~ 46325685 (-)
G712814 NA other downstream 1445315 45457777 ~ 45458248 (-)
G711133 NA other downstream 2364059 44538793 ~ 44539504 (-)
G709454 NA other downstream 3732481 43170760 ~ 43171082 (-)
G709272 NA other downstream 4182864 42719771 ~ 42720699 (-)
G714425 LOC106568665 other upstream 274662 47178424 ~ 47178736 (-)
G715865 NA other upstream 1385180 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 1638529 48356004 ~ 48616588 (-)
G716463 LOC106591423 other upstream 1856150 48759912 ~ 48761163 (-)

Expression


G714193 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G714193 Expression in each Bioproject

Bar chart with 8 bars.
G714193 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network