G714263 (LOC106568662)



Basic Information


Item Value
gene id G714263
gene name LOC106568662
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 46998395 ~ 46998644 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU811872
GGATTAAGTGAGTTGTTCTCCGAGGACTTGGTGGAGAGCAGGATGTGGGTGAAGCCATCCTGCTTCTTGACGACAAGGTCCCTGTAGCGGTAGGCACTCTCAGTCTGCCGGACGCTGAACCGAAGGCGCTTGTCGAAGACTGAGCGCTGCTCCTCGAAGCGCCGTTTCCCTGCCACCCCGGAGACTGGGGTGACTCCTGCCACTGCACTCTGCAGGCTAGCTGTCCCATTGGCCGCCAGAGCCTCCATGA

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU811872 True 250 lncRNA 0.60 1 46998395 46998644
Loading

Neighbor


gene id symbol gene type direction distance location
pex5lb LOC106568657 coding downstream 195226 46651828 ~ 46803169 (-)
si:ch1073-184j22.1 LOC106568655 coding downstream 441504 46527650 ~ 46556891 (-)
sft2d3 sft2d3 coding downstream 534703 46462625 ~ 46463692 (-)
dusp28 LOC106568652 coding downstream 580816 46407733 ~ 46417579 (-)
LOC110529956 LOC106568794 coding downstream 603277 46388942 ~ 46395118 (-)
nebl LOC106568663 coding upstream 17241 47015885 ~ 47027075 (-)
dnajc1 dnjc1 coding upstream 28550 47027194 ~ 47035362 (-)
LOC110529973 LOC106568664 coding upstream 52429 47051073 ~ 47067973 (-)
LOC110529976 LOC106568668 coding upstream 231443 47230087 ~ 47260852 (-)
LOC110529977 LOC106568669 coding upstream 285095 47283739 ~ 47295308 (-)
G714259 NA non-coding downstream 1464 46996636 ~ 46996931 (-)
G714240 NA non-coding downstream 24059 46974045 ~ 46974336 (-)
G714236 NA non-coding downstream 25326 46969881 ~ 46973069 (-)
G714235 NA non-coding downstream 28558 46969202 ~ 46969837 (-)
G714232 LOC106576489 non-coding downstream 34346 46963776 ~ 46964049 (-)
G714265 NA non-coding upstream 1839 47000483 ~ 47000699 (-)
G714266 LOC106568662 non-coding upstream 2401 47001045 ~ 47001685 (-)
G714262 NA non-coding upstream 5323 47003967 ~ 47010269 (-)
G714271 NA non-coding upstream 16955 47015599 ~ 47015811 (-)
G714276 NA non-coding upstream 37383 47036027 ~ 47036317 (-)
crfb16 LOC106568648 other downstream 672714 46309732 ~ 46325685 (-)
G712814 NA other downstream 1540147 45457777 ~ 45458248 (-)
G711133 NA other downstream 2458891 44538793 ~ 44539504 (-)
G709454 NA other downstream 3827313 43170760 ~ 43171082 (-)
G709272 NA other downstream 4277696 42719771 ~ 42720699 (-)
G714425 LOC106568665 other upstream 179780 47178424 ~ 47178736 (-)
G715865 NA other upstream 1290298 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 1543647 48356004 ~ 48616588 (-)
G716463 LOC106591423 other upstream 1761268 48759912 ~ 48761163 (-)

Expression


G714263(LOC106568662) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

G714263(LOC106568662) Expression in each Bioproject

Bar chart with 3 bars.
G714263(LOC106568662) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network