G714296



Basic Information


Item Value
gene id G714296
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 47075860 ~ 47076089 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU811910
acaaggtccacccttgcgcgtatttttctcatcgcctgtcgccgtcggaacgtaactatgatgtgggaaaccgcgaactgctcgccatccgcttagccctaggcgaatggcgacagtggttggaaggggcgaccgttccttttgtcgtttggactgaccataggaaccttgagtacatccgttctgccaaacgacttaatgcgcgtcaggctcgttgggctctgtttttc

Function


NR:

description
LOW QUALITY PROTEIN: uncharacterized protein LOC101167845

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU811910 True 230 lncRNA 0.54 1 47075860 47076089
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529973 LOC106568664 coding downstream 7887 47051073 ~ 47067973 (-)
dnajc1 dnjc1 coding downstream 40498 47027194 ~ 47035362 (-)
nebl LOC106568663 coding downstream 48785 47015885 ~ 47027075 (-)
pex5lb LOC106568657 coding downstream 272691 46651828 ~ 46803169 (-)
si:ch1073-184j22.1 LOC106568655 coding downstream 518969 46527650 ~ 46556891 (-)
LOC110529976 LOC106568668 coding upstream 153998 47230087 ~ 47260852 (-)
LOC110529977 LOC106568669 coding upstream 207650 47283739 ~ 47295308 (-)
LOC110529978 LOC106568670 coding upstream 222206 47298295 ~ 47303919 (-)
LOC110529981 LOC106568675 coding upstream 321694 47397783 ~ 47439942 (-)
LOC110529117 NA coding upstream 578963 47655052 ~ 47656068 (-)
G714290 NA non-coding downstream 6072 47069576 ~ 47069788 (-)
G714279 NA non-coding downstream 30364 47044704 ~ 47045496 (-)
G714276 NA non-coding downstream 39543 47036027 ~ 47036317 (-)
G714271 NA non-coding downstream 60049 47015599 ~ 47015811 (-)
G714262 NA non-coding downstream 65591 47003967 ~ 47010269 (-)
G714298 NA non-coding upstream 1672 47077761 ~ 47077967 (-)
G714300 NA non-coding upstream 3009 47079098 ~ 47079448 (-)
G714318 NA non-coding upstream 13426 47089515 ~ 47089752 (-)
G714330 NA non-coding upstream 25759 47101848 ~ 47102144 (-)
G714337 NA non-coding upstream 32246 47108335 ~ 47108690 (-)
crfb16 LOC106568648 other downstream 750179 46309732 ~ 46325685 (-)
G712814 NA other downstream 1617612 45457777 ~ 45458248 (-)
G711133 NA other downstream 2536356 44538793 ~ 44539504 (-)
G709454 NA other downstream 3904778 43170760 ~ 43171082 (-)
G714425 LOC106568665 other upstream 102335 47178424 ~ 47178736 (-)
G715865 NA other upstream 1212853 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 1466202 48356004 ~ 48616588 (-)
G716463 LOC106591423 other upstream 1683823 48759912 ~ 48761163 (-)
G716480 tnk2 other upstream 1706032 48782121 ~ 48782515 (-)

Expression


G714296 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G714296 Expression in each Bioproject

Bar chart with 6 bars.
G714296 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network