G714337



Basic Information


Item Value
gene id G714337
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 47108335 ~ 47108690 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU811951
tagcattcttcttgccaatgtccagtctcttgacaacaaggttgatgaaatccgagcaagggtagcattccagagggacatcagagactgtaacgttctttgcttcacggaaacgtggcttactggagagacgctatccgaagcggtgcagccaacaggtttctccacgcatcgcgcagacaggaaaaaaacatctttctggtaaaaagaggggcgggggcgtatgccttatgactaacgtgacatggtgcgatgaaagaaacatacaggaactcaaatccttctgttcacctgatttagaattcctcacaatcaaatgtagaccgcattatctaccaagagaattctcttcgatt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU811951 True 356 lncRNA 0.46 1 47108335 47108690
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529973 LOC106568664 coding downstream 40362 47051073 ~ 47067973 (-)
dnajc1 dnjc1 coding downstream 72973 47027194 ~ 47035362 (-)
nebl LOC106568663 coding downstream 81260 47015885 ~ 47027075 (-)
pex5lb LOC106568657 coding downstream 305166 46651828 ~ 46803169 (-)
si:ch1073-184j22.1 LOC106568655 coding downstream 551444 46527650 ~ 46556891 (-)
LOC110529976 LOC106568668 coding upstream 121397 47230087 ~ 47260852 (-)
LOC110529977 LOC106568669 coding upstream 175049 47283739 ~ 47295308 (-)
LOC110529978 LOC106568670 coding upstream 189605 47298295 ~ 47303919 (-)
LOC110529981 LOC106568675 coding upstream 289093 47397783 ~ 47439942 (-)
LOC110529117 NA coding upstream 546362 47655052 ~ 47656068 (-)
G714330 NA non-coding downstream 6191 47101848 ~ 47102144 (-)
G714318 NA non-coding downstream 18583 47089515 ~ 47089752 (-)
G714300 NA non-coding downstream 28887 47079098 ~ 47079448 (-)
G714298 NA non-coding downstream 30368 47077761 ~ 47077967 (-)
G714296 NA non-coding downstream 32246 47075860 ~ 47076089 (-)
G714393 NA non-coding upstream 10053 47118743 ~ 47119430 (-)
G714414 NA non-coding upstream 55165 47163855 ~ 47164140 (-)
G714418 NA non-coding upstream 60637 47169327 ~ 47169929 (-)
G714420 NA non-coding upstream 63134 47171824 ~ 47172422 (-)
G714421 NA non-coding upstream 63919 47172609 ~ 47172872 (-)
crfb16 LOC106568648 other downstream 782654 46309732 ~ 46325685 (-)
G712814 NA other downstream 1650087 45457777 ~ 45458248 (-)
G711133 NA other downstream 2568831 44538793 ~ 44539504 (-)
G709454 NA other downstream 3937253 43170760 ~ 43171082 (-)
G714425 LOC106568665 other upstream 69734 47178424 ~ 47178736 (-)
G715865 NA other upstream 1180252 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 1433601 48356004 ~ 48616588 (-)
G716463 LOC106591423 other upstream 1651222 48759912 ~ 48761163 (-)
G716480 tnk2 other upstream 1673431 48782121 ~ 48782515 (-)

Expression


G714337 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G714337 Expression in each Bioproject

Bar chart with 19 bars.
G714337 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network