G714423 (LOC106568665)



Basic Information


Item Value
gene id G714423
gene name LOC106568665
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 47176799 ~ 47177022 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU812041
CCCAGGCTTAATGTACTTACCTTGCCTGGGAAAAAGGAACTGTTCTTGAACTTGCGCAGGTAAAACGCAATGAAGAACGTTCCGGACATTAGCACCAACGTCAGGAGGGCTGTGTTGGGCTCCCCCACCACCTTGCCAGGCACGCCAACCACAGTGTCGTTGCATGATGAGGATGTCCATGTGTCGTTGACCAGGTAACAGCGTTGGAGAGGATGCTCTTGAAA

Function


NR:

description
anion exchange protein 2-like isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU812041 True 224 lncRNA 0.52 1 47176799 47177022
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529973 LOC106568664 coding downstream 108826 47051073 ~ 47067973 (-)
dnajc1 dnjc1 coding downstream 141437 47027194 ~ 47035362 (-)
nebl LOC106568663 coding downstream 149724 47015885 ~ 47027075 (-)
pex5lb LOC106568657 coding downstream 373630 46651828 ~ 46803169 (-)
si:ch1073-184j22.1 LOC106568655 coding downstream 619908 46527650 ~ 46556891 (-)
LOC110529976 LOC106568668 coding upstream 53065 47230087 ~ 47260852 (-)
LOC110529977 LOC106568669 coding upstream 106717 47283739 ~ 47295308 (-)
LOC110529978 LOC106568670 coding upstream 121273 47298295 ~ 47303919 (-)
LOC110529981 LOC106568675 coding upstream 220761 47397783 ~ 47439942 (-)
LOC110529117 NA coding upstream 478030 47655052 ~ 47656068 (-)
G714422 NA non-coding downstream 2791 47172988 ~ 47174008 (-)
G714421 NA non-coding downstream 3927 47172609 ~ 47172872 (-)
G714420 NA non-coding downstream 4377 47171824 ~ 47172422 (-)
G714418 NA non-coding downstream 6870 47169327 ~ 47169929 (-)
G714414 NA non-coding downstream 12659 47163855 ~ 47164140 (-)
G714424 NA non-coding upstream 697 47177719 ~ 47177947 (-)
G714428 NA non-coding upstream 14312 47191334 ~ 47191962 (-)
G714429 NA non-coding upstream 16335 47193357 ~ 47196528 (-)
G714430 NA non-coding upstream 20634 47197656 ~ 47198344 (-)
G714435 NA non-coding upstream 25630 47202652 ~ 47202881 (-)
crfb16 LOC106568648 other downstream 851118 46309732 ~ 46325685 (-)
G712814 NA other downstream 1718551 45457777 ~ 45458248 (-)
G711133 NA other downstream 2637295 44538793 ~ 44539504 (-)
G709454 NA other downstream 4005717 43170760 ~ 43171082 (-)
G714425 LOC106568665 other upstream 1402 47178424 ~ 47178736 (-)
G715865 NA other upstream 1111920 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 1365269 48356004 ~ 48616588 (-)
G716463 LOC106591423 other upstream 1582890 48759912 ~ 48761163 (-)
G716480 tnk2 other upstream 1605099 48782121 ~ 48782515 (-)

Expression


G714423(LOC106568665) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G714423(LOC106568665) Expression in each Bioproject

Bar chart with 4 bars.
G714423(LOC106568665) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.

Co-expression Network