G714424



Basic Information


Item Value
gene id G714424
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 47177719 ~ 47177947 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU812042
TTAGCAACGACATGGGGATTTTGTCTCCGATTTCAAAAACTTATCTCGGAAAGCTAAATCATAGCCTTGTGTACACCCGGCTTACGTGGTGATCTGTGTCTCCATGAAGATGAGGATGAAGACGAGCAGGGCAGGTAAGATGCTGGTGGCCATCATCCAGACAGGGAACTGTCCGTCCGAGCCCAGCGGGGGGATCAGCCACTGCCGCTTTTCAGGACTGGTCACCGAG

Function


NR:

description
PREDICTED: anion exchange protein 2-like isoform X5

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU812042 True 229 lncRNA 0.53 1 47177719 47177947
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529973 LOC106568664 coding downstream 109746 47051073 ~ 47067973 (-)
dnajc1 dnjc1 coding downstream 142357 47027194 ~ 47035362 (-)
nebl LOC106568663 coding downstream 150644 47015885 ~ 47027075 (-)
pex5lb LOC106568657 coding downstream 374550 46651828 ~ 46803169 (-)
si:ch1073-184j22.1 LOC106568655 coding downstream 620828 46527650 ~ 46556891 (-)
LOC110529976 LOC106568668 coding upstream 52140 47230087 ~ 47260852 (-)
LOC110529977 LOC106568669 coding upstream 105792 47283739 ~ 47295308 (-)
LOC110529978 LOC106568670 coding upstream 120348 47298295 ~ 47303919 (-)
LOC110529981 LOC106568675 coding upstream 219836 47397783 ~ 47439942 (-)
LOC110529117 NA coding upstream 477105 47655052 ~ 47656068 (-)
G714423 LOC106568665 non-coding downstream 697 47176799 ~ 47177022 (-)
G714422 NA non-coding downstream 3711 47172988 ~ 47174008 (-)
G714421 NA non-coding downstream 4847 47172609 ~ 47172872 (-)
G714420 NA non-coding downstream 5297 47171824 ~ 47172422 (-)
G714418 NA non-coding downstream 7790 47169327 ~ 47169929 (-)
G714428 NA non-coding upstream 13387 47191334 ~ 47191962 (-)
G714429 NA non-coding upstream 15410 47193357 ~ 47196528 (-)
G714430 NA non-coding upstream 19709 47197656 ~ 47198344 (-)
G714435 NA non-coding upstream 24705 47202652 ~ 47202881 (-)
G714440 LOC106562530 non-coding upstream 30032 47207979 ~ 47208345 (-)
crfb16 LOC106568648 other downstream 852038 46309732 ~ 46325685 (-)
G712814 NA other downstream 1719471 45457777 ~ 45458248 (-)
G711133 NA other downstream 2638215 44538793 ~ 44539504 (-)
G709454 NA other downstream 4006637 43170760 ~ 43171082 (-)
G714425 LOC106568665 other upstream 477 47178424 ~ 47178736 (-)
G715865 NA other upstream 1110995 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 1364344 48356004 ~ 48616588 (-)
G716463 LOC106591423 other upstream 1581965 48759912 ~ 48761163 (-)
G716480 tnk2 other upstream 1604174 48782121 ~ 48782515 (-)

Expression


G714424 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G714424 Expression in each Bioproject

Bar chart with 2 bars.
G714424 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network