G714425 (LOC106568665)



Basic Information


Item Value
gene id G714425
gene name LOC106568665
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 47178424 ~ 47178736 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU812043
ATTTTGCGACCCTACTCTCGATTTAGTCCTGGGCACTAAGTTAGAGGGGTCATGCCTACCGACAAACAGAGCTACGAGGAAGCCCGTCACCCTCTGCTCTTTCACTTCATGGATACGGGGCTTGTCGCCGGGGGCCACCGCCTTGCTCATGACGGTAAGGGCGTTTGCGTGAGTAACAGAACGCACGGTGGCGGCGGCCAACCAGGGCAGACCGAACAGGGCCGAAACCCCACCTATGGCCACGATGATGAGCAGGTCCAGGTGGAAGCCGGAGCCCTTCAACAGCATCCGTTCCTTCTTACTGACTATCAGC

Function


NR:

description
anion exchange protein 2-like isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU812043 True 313 TUCP 0.58 1 47178424 47178736
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529973 LOC106568664 coding downstream 110451 47051073 ~ 47067973 (-)
dnajc1 dnjc1 coding downstream 143062 47027194 ~ 47035362 (-)
nebl LOC106568663 coding downstream 151349 47015885 ~ 47027075 (-)
pex5lb LOC106568657 coding downstream 375255 46651828 ~ 46803169 (-)
si:ch1073-184j22.1 LOC106568655 coding downstream 621533 46527650 ~ 46556891 (-)
LOC110529976 LOC106568668 coding upstream 51351 47230087 ~ 47260852 (-)
LOC110529977 LOC106568669 coding upstream 105003 47283739 ~ 47295308 (-)
LOC110529978 LOC106568670 coding upstream 119559 47298295 ~ 47303919 (-)
LOC110529981 LOC106568675 coding upstream 219047 47397783 ~ 47439942 (-)
LOC110529117 NA coding upstream 476316 47655052 ~ 47656068 (-)
G714424 NA non-coding downstream 477 47177719 ~ 47177947 (-)
G714423 LOC106568665 non-coding downstream 1402 47176799 ~ 47177022 (-)
G714422 NA non-coding downstream 4416 47172988 ~ 47174008 (-)
G714421 NA non-coding downstream 5552 47172609 ~ 47172872 (-)
G714420 NA non-coding downstream 6002 47171824 ~ 47172422 (-)
G714428 NA non-coding upstream 12598 47191334 ~ 47191962 (-)
G714429 NA non-coding upstream 14621 47193357 ~ 47196528 (-)
G714430 NA non-coding upstream 18920 47197656 ~ 47198344 (-)
G714435 NA non-coding upstream 23916 47202652 ~ 47202881 (-)
G714440 LOC106562530 non-coding upstream 29243 47207979 ~ 47208345 (-)
crfb16 LOC106568648 other downstream 852743 46309732 ~ 46325685 (-)
G712814 NA other downstream 1720176 45457777 ~ 45458248 (-)
G711133 NA other downstream 2638920 44538793 ~ 44539504 (-)
G709454 NA other downstream 4007342 43170760 ~ 43171082 (-)
G715865 NA other upstream 1110206 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 1363555 48356004 ~ 48616588 (-)
G716463 LOC106591423 other upstream 1581176 48759912 ~ 48761163 (-)
G716480 tnk2 other upstream 1603385 48782121 ~ 48782515 (-)
G716488 NA other upstream 1609785 48788521 ~ 48788962 (-)

Expression


G714425(LOC106568665) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G714425(LOC106568665) Expression in each Bioproject

Bar chart with 7 bars.
G714425(LOC106568665) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network