G714435



Basic Information


Item Value
gene id G714435
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 47202652 ~ 47202881 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU812053
caccagtctgctgttcccacatgcttcaagagggccaccattgttcccgttcccaagaaagctaaggtaactgagctaaacgactaccaccccgtagcactcacttccgtcatcatgaagtgctttgagagactagtcaaggaccatatcacctctaccctacccgacaccctagacccactccaatttgcttaccgcccaaataggtccacagacgatgcaatctcaac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU812053 True 230 lncRNA 0.51 1 47202652 47202881
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529973 LOC106568664 coding downstream 134679 47051073 ~ 47067973 (-)
dnajc1 dnjc1 coding downstream 167290 47027194 ~ 47035362 (-)
nebl LOC106568663 coding downstream 175577 47015885 ~ 47027075 (-)
pex5lb LOC106568657 coding downstream 399483 46651828 ~ 46803169 (-)
si:ch1073-184j22.1 LOC106568655 coding downstream 645761 46527650 ~ 46556891 (-)
LOC110529976 LOC106568668 coding upstream 27206 47230087 ~ 47260852 (-)
LOC110529977 LOC106568669 coding upstream 80858 47283739 ~ 47295308 (-)
LOC110529978 LOC106568670 coding upstream 95414 47298295 ~ 47303919 (-)
LOC110529981 LOC106568675 coding upstream 194902 47397783 ~ 47439942 (-)
LOC110529117 NA coding upstream 452171 47655052 ~ 47656068 (-)
G714430 NA non-coding downstream 4308 47197656 ~ 47198344 (-)
G714429 NA non-coding downstream 6124 47193357 ~ 47196528 (-)
G714428 NA non-coding downstream 10690 47191334 ~ 47191962 (-)
G714424 NA non-coding downstream 24705 47177719 ~ 47177947 (-)
G714423 LOC106568665 non-coding downstream 25630 47176799 ~ 47177022 (-)
G714440 LOC106562530 non-coding upstream 5098 47207979 ~ 47208345 (-)
G714689 NA non-coding upstream 25886 47228767 ~ 47229293 (-)
G714764 NA non-coding upstream 149312 47352193 ~ 47388487 (-)
G714816 NA non-coding upstream 248576 47451457 ~ 47451848 (-)
G714425 LOC106568665 other downstream 23916 47178424 ~ 47178736 (-)
crfb16 LOC106568648 other downstream 876971 46309732 ~ 46325685 (-)
G712814 NA other downstream 1744404 45457777 ~ 45458248 (-)
G711133 NA other downstream 2663148 44538793 ~ 44539504 (-)
G715865 NA other upstream 1086061 48288942 ~ 48289581 (-)
dlg1l LOC106568684 other upstream 1339410 48356004 ~ 48616588 (-)
G716463 LOC106591423 other upstream 1557031 48759912 ~ 48761163 (-)
G716480 tnk2 other upstream 1579240 48782121 ~ 48782515 (-)
G716488 NA other upstream 1585640 48788521 ~ 48788962 (-)

Expression


G714435 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G714435 Expression in each Bioproject

Bar chart with 16 bars.
G714435 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network