G715105



Basic Information


Item Value
gene id G715105
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 47719750 ~ 47720233 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU812768
actccagccactttaataatgggaattgatgggaaatgacgtaaatatatcactagccactttaaacaatgctaccttatataaatgttacttaccctacattattcatctcatatgcatacgtatatactgtactctatatcatcgacggtatccttatgtaatacatgtatcactagccactttatactatactatgccactttttttacatactcatctcatttgtacatactgtactcgataccatctactgtatcttgcctatgctgctctgtaccatcactcattcatatatccttatgtacatattctttatccccttacactgtgtacaagacagtagttttggaattgttagttagattacttgttattactgcattgtcggaactagaagcacaagcatttcgctacactcgcactaacatctgctaaccatgtgtatgtgacaaatacaatttgatttgatttgatttgattt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU812768 True 484 lncRNA 0.34 1 47719750 47720233

Neighbor


gene id symbol gene type direction distance location
LOC110529117 NA coding downstream 63682 47655052 ~ 47656068 (-)
LOC110529981 LOC106568675 coding downstream 279808 47397783 ~ 47439942 (-)
LOC110529978 LOC106568670 coding downstream 415831 47298295 ~ 47303919 (-)
LOC110529977 LOC106568669 coding downstream 424442 47283739 ~ 47295308 (-)
LOC110529976 LOC106568668 coding downstream 458898 47230087 ~ 47260852 (-)
LOC110529987 LOC106568679 coding upstream 6557 47726790 ~ 47894176 (-)
LOC110529989 LOC106568683 coding upstream 609451 48329684 ~ 48343010 (-)
dlg1l LOC106568684 coding upstream 635771 48356004 ~ 48616588 (-)
LOC118965521 NA coding upstream 811289 48531522 ~ 48536626 (-)
LOC110529994 LOC106568693 coding upstream 1401816 49122049 ~ 49140712 (-)
G715095 NA non-coding downstream 4967 47714582 ~ 47714783 (-)
G715088 NA non-coding downstream 11797 47707647 ~ 47707953 (-)
G715087 NA non-coding downstream 12166 47707353 ~ 47707584 (-)
G715083 NA non-coding downstream 15280 47704219 ~ 47704470 (-)
G715079 NA non-coding downstream 21878 47697587 ~ 47697872 (-)
G715107 NA non-coding upstream 581 47720814 ~ 47721174 (-)
G715110 NA non-coding upstream 1836 47722069 ~ 47722312 (-)
G715111 NA non-coding upstream 2326 47722559 ~ 47722797 (-)
G715115 NA non-coding upstream 4801 47725034 ~ 47725335 (-)
G714425 LOC106568665 other downstream 541014 47178424 ~ 47178736 (-)
LOC110529973 LOC106568664 other downstream 662090 47051073 ~ 47067973 (-)
crfb16 LOC106568648 other downstream 1394069 46309732 ~ 46325685 (-)
G712814 NA other downstream 2261502 45457777 ~ 45458248 (-)
G711133 NA other downstream 3180246 44538793 ~ 44539504 (-)
G715865 NA other upstream 568709 48288942 ~ 48289581 (-)
G716463 LOC106591423 other upstream 1039679 48759912 ~ 48761163 (-)
G716480 tnk2 other upstream 1061888 48782121 ~ 48782515 (-)
G716488 NA other upstream 1068288 48788521 ~ 48788962 (-)

Expression


G715105 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G715105 Expression in each Bioproject

Bar chart with 19 bars.
G715105 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network