G715292



Basic Information


Item Value
gene id G715292
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 47751080 ~ 47751725 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU812960
aggaacagagtaggagtagaataagggtgcggctaaaagcaataagaattggtcgtttagaacgtctggaacagagagtaaaaggaggtttctgggggtgataaaatagcatcaaggtataatgtacagacaaaggtaaggtaggatgtgaatacagtggaggtaaacctaggtattgagtgatgaagagagagatattgtctctagaaacatcattgaaaccaggagatgtcattgcatgtgtgggtggtggaactaataggttggataaggtataatgagcaggactagaggctctacagtgaaataagccaataaacactaaccagaacagcaatggacaaggcatattgacattaaggaaaggcatgctcagtcgagtgatcaaaagggtccagtgagtggagaggttggttgggggtcacggcgatttagacagctaaatcggtagcaagctagcataggagcaagctagcataggatggaggtctgttattagccaactcttgcgttccgtcagtagattagtgggtttccgtgtggtagaggggattaatccaaatcacacaacaacaacaaaaataaaaacaatagatgtagttatagaggcccaagaagaaaaataaataaataaaaaaattaaata
>TU812959
aggaacagagtaggagtagaataagggtgcggctaaaagcaataagaattggtcgtttagaacgtctggaacagagagtaaaaggaggtttctgggggtgataaaatagcatcaaggtataatgtacagacaaaggtaaggtaggatgtgaatacagtggaggtaaacctaggtattgagtgatgaagagagagatattgtctctagaaacatcattgaaaccaggagatgtcattgcatgtgtgggtggtggaactaataggttggataaggtataatgagcaggactagaggctctacagtgaaataagccaataaacactaaccagaacagcaatggacaaggcatattgacattaaggaaaggcatgctcagtcgagtgatcaaaagggtccagtgagtggagaggttggttgggggtcacggcgatttagacagctaaatcggtagcaagctagcataggagcaagctagcataggatggaggtctgttattagccaactcttgcgttccgtcagtag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU812960 False 646 lncRNA 0.41 1 47751080 47751725
TU812959 True 523 lncRNA 0.44 1 47751203 47751725

Neighbor


gene id symbol gene type direction distance location
LOC110529117 NA coding downstream 95012 47655052 ~ 47656068 (-)
LOC110529981 LOC106568675 coding downstream 311138 47397783 ~ 47439942 (-)
LOC110529978 LOC106568670 coding downstream 447161 47298295 ~ 47303919 (-)
LOC110529977 LOC106568669 coding downstream 455772 47283739 ~ 47295308 (-)
LOC110529976 LOC106568668 coding downstream 490228 47230087 ~ 47260852 (-)
LOC110529989 LOC106568683 coding upstream 577959 48329684 ~ 48343010 (-)
dlg1l LOC106568684 coding upstream 604279 48356004 ~ 48616588 (-)
LOC118965521 NA coding upstream 779797 48531522 ~ 48536626 (-)
LOC110529994 LOC106568693 coding upstream 1370324 49122049 ~ 49140712 (-)
LOC118965653 NA coding upstream 1645074 49396799 ~ 49396853 (-)
LOC110529987 LOC106568679 non-coding downstream 20661 47726790 ~ 47894176 (-)
G715115 NA non-coding downstream 25745 47725034 ~ 47725335 (-)
G715111 NA non-coding downstream 28283 47722559 ~ 47722797 (-)
G715110 NA non-coding downstream 28768 47722069 ~ 47722312 (-)
G715107 NA non-coding downstream 29906 47720814 ~ 47721174 (-)
G715330 NA non-coding upstream 63600 47815325 ~ 47815939 (-)
G715335 NA non-coding upstream 71373 47823098 ~ 47823383 (-)
G715340 NA non-coding upstream 77455 47829180 ~ 47871114 (-)
G715432 NA non-coding upstream 207485 47959210 ~ 47959437 (-)
G715438 NA non-coding upstream 213679 47965404 ~ 47965620 (-)
G714425 LOC106568665 other downstream 572344 47178424 ~ 47178736 (-)
LOC110529973 LOC106568664 other downstream 693420 47051073 ~ 47067973 (-)
crfb16 LOC106568648 other downstream 1425399 46309732 ~ 46325685 (-)
G712814 NA other downstream 2292832 45457777 ~ 45458248 (-)
G711133 NA other downstream 3211576 44538793 ~ 44539504 (-)
G715865 NA other upstream 537217 48288942 ~ 48289581 (-)
G716463 LOC106591423 other upstream 1008187 48759912 ~ 48761163 (-)
G716480 tnk2 other upstream 1030396 48782121 ~ 48782515 (-)
G716488 NA other upstream 1036796 48788521 ~ 48788962 (-)

Expression


G715292 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G715292 Expression in each Bioproject

Bar chart with 20 bars.
G715292 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network