G715330



Basic Information


Item Value
gene id G715330
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 47815325 ~ 47815939 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU813001
gatataaaactgtatattttgtgaagaatcaacaacaagtgggacacaatcatgaagtggaacgaaatttattggatatttcaaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaactattcagcccctttactttcagtgcagcaaactctctccagaagatcagtgaggatctctgaatgatccaatgtagacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacatggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagcccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgctgagatctacagctgaggtgggagactctgtccatagg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU813001 True 615 lncRNA 0.42 1 47815325 47815939
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529117 NA coding downstream 159257 47655052 ~ 47656068 (-)
LOC110529981 LOC106568675 coding downstream 375383 47397783 ~ 47439942 (-)
LOC110529978 LOC106568670 coding downstream 511406 47298295 ~ 47303919 (-)
LOC110529977 LOC106568669 coding downstream 520017 47283739 ~ 47295308 (-)
LOC110529976 LOC106568668 coding downstream 554473 47230087 ~ 47260852 (-)
LOC110529989 LOC106568683 coding upstream 513745 48329684 ~ 48343010 (-)
dlg1l LOC106568684 coding upstream 540065 48356004 ~ 48616588 (-)
LOC118965521 NA coding upstream 715583 48531522 ~ 48536626 (-)
LOC110529994 LOC106568693 coding upstream 1306110 49122049 ~ 49140712 (-)
LOC118965653 NA coding upstream 1580860 49396799 ~ 49396853 (-)
G715292 NA non-coding downstream 63600 47751080 ~ 47751725 (-)
LOC110529987 LOC106568679 non-coding downstream 84906 47726790 ~ 47894176 (-)
G715115 NA non-coding downstream 89990 47725034 ~ 47725335 (-)
G715111 NA non-coding downstream 92528 47722559 ~ 47722797 (-)
G715110 NA non-coding downstream 93013 47722069 ~ 47722312 (-)
G715335 NA non-coding upstream 7159 47823098 ~ 47823383 (-)
G715340 NA non-coding upstream 13241 47829180 ~ 47871114 (-)
G715432 NA non-coding upstream 143271 47959210 ~ 47959437 (-)
G715438 NA non-coding upstream 149465 47965404 ~ 47965620 (-)
G715447 NA non-coding upstream 158793 47974732 ~ 47974964 (-)
G714425 LOC106568665 other downstream 636589 47178424 ~ 47178736 (-)
LOC110529973 LOC106568664 other downstream 757665 47051073 ~ 47067973 (-)
crfb16 LOC106568648 other downstream 1489644 46309732 ~ 46325685 (-)
G712814 NA other downstream 2357077 45457777 ~ 45458248 (-)
G711133 NA other downstream 3275821 44538793 ~ 44539504 (-)
G715865 NA other upstream 473003 48288942 ~ 48289581 (-)
G716463 LOC106591423 other upstream 943973 48759912 ~ 48761163 (-)
G716480 tnk2 other upstream 966182 48782121 ~ 48782515 (-)
G716488 NA other upstream 972582 48788521 ~ 48788962 (-)

Expression


G715330 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G715330 Expression in each Bioproject

Bar chart with 20 bars.
G715330 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network