G715581



Basic Information


Item Value
gene id G715581
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 48074163 ~ 48074530 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU813256
tccagggccacctctcttcctccacaccggtcgtatgattgtagtattgatctccttccgggaaccactcccccccggggtagactatactctctgtcggctcccgaacgtaaggctctcaaagattatttgtctgtagctcttgacgccggtaccatagtcccctcctcctctcccgccggagcggggttttttttttgtcaagaagaaggacgggtctctgcgcccctgcatagattatcgagggctgaatgacataacagtgaagaatcgttatccgcttcctcttatgtcttcagccttcgagatcctgcagggagccaggtttttcactaagttggaccttcgtaacgcttaccatctcgtgc

Function


NR:

description
PREDICTED: uncharacterized protein LOC109045530

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU813256 True 368 lncRNA 0.52 1 48074163 48074530

Neighbor


gene id symbol gene type direction distance location
LOC110529987 LOC106568679 coding downstream 179987 47726790 ~ 47894176 (-)
LOC110529117 NA coding downstream 418095 47655052 ~ 47656068 (-)
LOC110529981 LOC106568675 coding downstream 634221 47397783 ~ 47439942 (-)
LOC110529978 LOC106568670 coding downstream 770244 47298295 ~ 47303919 (-)
LOC110529977 LOC106568669 coding downstream 778855 47283739 ~ 47295308 (-)
LOC110529989 LOC106568683 coding upstream 255154 48329684 ~ 48343010 (-)
dlg1l LOC106568684 coding upstream 281474 48356004 ~ 48616588 (-)
LOC118965521 NA coding upstream 456992 48531522 ~ 48536626 (-)
LOC110529994 LOC106568693 coding upstream 1047519 49122049 ~ 49140712 (-)
LOC118965653 NA coding upstream 1322269 49396799 ~ 49396853 (-)
G715578 NA non-coding downstream 1859 48071971 ~ 48072304 (-)
G715572 NA non-coding downstream 8132 48065799 ~ 48066031 (-)
G715565 NA non-coding downstream 15499 48058427 ~ 48058664 (-)
G715563 NA non-coding downstream 16775 48057168 ~ 48057388 (-)
G715467 NA non-coding downstream 84799 47989026 ~ 47989364 (-)
G715585 NA non-coding upstream 1340 48075870 ~ 48076171 (-)
G715645 NA non-coding upstream 37184 48111714 ~ 48113292 (-)
G715625 NA non-coding upstream 44785 48119315 ~ 48120151 (-)
G715717 NA non-coding upstream 89200 48163730 ~ 48164225 (-)
G715715 NA non-coding upstream 93244 48167774 ~ 48168935 (-)
G714425 LOC106568665 other downstream 895427 47178424 ~ 47178736 (-)
LOC110529973 LOC106568664 other downstream 1016503 47051073 ~ 47067973 (-)
crfb16 LOC106568648 other downstream 1748482 46309732 ~ 46325685 (-)
G712814 NA other downstream 2615915 45457777 ~ 45458248 (-)
G711133 NA other downstream 3534659 44538793 ~ 44539504 (-)
G715865 NA other upstream 214412 48288942 ~ 48289581 (-)
G716463 LOC106591423 other upstream 685382 48759912 ~ 48761163 (-)
G716480 tnk2 other upstream 707591 48782121 ~ 48782515 (-)
G716488 NA other upstream 713991 48788521 ~ 48788962 (-)

Expression


G715581 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G715581 Expression in each Bioproject

Bar chart with 21 bars.
G715581 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network