G715824



Basic Information


Item Value
gene id G715824
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 48257722 ~ 48258017 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU813516
tttcaaatcaaatcaaatttattttatatagcccttcgtacatcagctgatatctcaaagtgctgtacagaaacccagcctaaaaccccaaacagcaagcaatgcaggtgaagaagcacggtggctaggaaaaaactccctagaaaggccaaaacctaggaagaaacctagagaggaaccaggctatgtggggtggccagtcctcttctggctgtgccgggtggagattataacaaaacatggtcaagatgttcaaatgttcataaatgaccagcatggtcgaataataataaggc

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU813516 True 296 lncRNA 0.43 1 48257722 48258017
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529987 LOC106568679 coding downstream 363546 47726790 ~ 47894176 (-)
LOC110529117 NA coding downstream 601654 47655052 ~ 47656068 (-)
LOC110529981 LOC106568675 coding downstream 817780 47397783 ~ 47439942 (-)
LOC110529978 LOC106568670 coding downstream 953803 47298295 ~ 47303919 (-)
LOC110529977 LOC106568669 coding downstream 962414 47283739 ~ 47295308 (-)
LOC110529989 LOC106568683 coding upstream 71667 48329684 ~ 48343010 (-)
dlg1l LOC106568684 coding upstream 97987 48356004 ~ 48616588 (-)
LOC118965521 NA coding upstream 273505 48531522 ~ 48536626 (-)
LOC110529994 LOC106568693 coding upstream 864032 49122049 ~ 49140712 (-)
LOC118965653 NA coding upstream 1138782 49396799 ~ 49396853 (-)
G715789 NA non-coding downstream 27520 48221706 ~ 48230202 (-)
G715783 NA non-coding downstream 37880 48219633 ~ 48219842 (-)
G715781 NA non-coding downstream 38542 48218926 ~ 48219180 (-)
G715758 NA non-coding downstream 51266 48206238 ~ 48206456 (-)
G715734 NA non-coding downstream 69010 48188488 ~ 48188712 (-)
G715860 NA non-coding upstream 27874 48285891 ~ 48286307 (-)
G715862 NA non-coding upstream 29015 48287032 ~ 48287824 (-)
G716253 NA non-coding upstream 40548 48298565 ~ 48298788 (-)
G716261 NA non-coding upstream 50169 48308186 ~ 48308467 (-)
G716285 NA non-coding upstream 88826 48346843 ~ 48347043 (-)
G714425 LOC106568665 other downstream 1078986 47178424 ~ 47178736 (-)
LOC110529973 LOC106568664 other downstream 1200062 47051073 ~ 47067973 (-)
crfb16 LOC106568648 other downstream 1932041 46309732 ~ 46325685 (-)
G712814 NA other downstream 2799474 45457777 ~ 45458248 (-)
G711133 NA other downstream 3718218 44538793 ~ 44539504 (-)
G715865 NA other upstream 30925 48288942 ~ 48289581 (-)
G716463 LOC106591423 other upstream 501895 48759912 ~ 48761163 (-)
G716480 tnk2 other upstream 524104 48782121 ~ 48782515 (-)
G716488 NA other upstream 530504 48788521 ~ 48788962 (-)

Expression


G715824 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G715824 Expression in each Bioproject

Bar chart with 14 bars.
G715824 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network