G715860



Basic Information


Item Value
gene id G715860
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 48285891 ~ 48286307 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU813552
agaggagttgggttccctctcgggacgtgctggaccgtgcgctgattgatgatttcctccgttgccgccaggtttcctcctcgagtgcgccaggaggcgctcggtgagtgggggggtactgtcatgtactgtcatgttgtcttgtctctgtcctttcccttcactctgtctccctctgctggtcgtgttaggttaccttttctcccccgctttcccccagctgtcccttgtctcctctaactacccattcaccccgttccccacctgttccctttttccctctgattaggtccctatatctctctctgtttctgctcctgtccttgtcggattcttgtttgtttgtgtcattcatgcctgaaccagactgccgtcatgtttgctgtaaccttgtcctgtcctgtcggaatctgccgg

Function


GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU813552 True 417 lncRNA 0.54 1 48285891 48286307
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529987 LOC106568679 coding downstream 391715 47726790 ~ 47894176 (-)
LOC110529117 NA coding downstream 629823 47655052 ~ 47656068 (-)
LOC110529981 LOC106568675 coding downstream 845949 47397783 ~ 47439942 (-)
LOC110529978 LOC106568670 coding downstream 981972 47298295 ~ 47303919 (-)
LOC110529977 LOC106568669 coding downstream 990583 47283739 ~ 47295308 (-)
LOC110529989 LOC106568683 coding upstream 43377 48329684 ~ 48343010 (-)
dlg1l LOC106568684 coding upstream 69697 48356004 ~ 48616588 (-)
LOC118965521 NA coding upstream 245215 48531522 ~ 48536626 (-)
LOC110529994 LOC106568693 coding upstream 835742 49122049 ~ 49140712 (-)
LOC118965653 NA coding upstream 1110492 49396799 ~ 49396853 (-)
G715824 NA non-coding downstream 27874 48257722 ~ 48258017 (-)
G715789 NA non-coding downstream 55689 48221706 ~ 48230202 (-)
G715783 NA non-coding downstream 66049 48219633 ~ 48219842 (-)
G715781 NA non-coding downstream 66711 48218926 ~ 48219180 (-)
G715758 NA non-coding downstream 79435 48206238 ~ 48206456 (-)
G715862 NA non-coding upstream 725 48287032 ~ 48287824 (-)
G716253 NA non-coding upstream 12258 48298565 ~ 48298788 (-)
G716261 NA non-coding upstream 21879 48308186 ~ 48308467 (-)
G716285 NA non-coding upstream 60536 48346843 ~ 48347043 (-)
G716288 NA non-coding upstream 63291 48349598 ~ 48349811 (-)
G714425 LOC106568665 other downstream 1107155 47178424 ~ 47178736 (-)
LOC110529973 LOC106568664 other downstream 1228231 47051073 ~ 47067973 (-)
crfb16 LOC106568648 other downstream 1960210 46309732 ~ 46325685 (-)
G712814 NA other downstream 2827643 45457777 ~ 45458248 (-)
G711133 NA other downstream 3746387 44538793 ~ 44539504 (-)
G715865 NA other upstream 2635 48288942 ~ 48289581 (-)
G716463 LOC106591423 other upstream 473605 48759912 ~ 48761163 (-)
G716480 tnk2 other upstream 495814 48782121 ~ 48782515 (-)
G716488 NA other upstream 502214 48788521 ~ 48788962 (-)

Expression


G715860 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G715860 Expression in each Bioproject

Bar chart with 20 bars.
G715860 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network