G716509



Basic Information


Item Value
gene id G716509
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 48827976 ~ 48828526 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU814250
gatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccataaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtgggcatggtgtgttcagggtgatgagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttcgtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacaacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaatatacgactgattgttgtcctattgacagagtctcccacctcagctgtagatctctgcagtcatccagagtgatcatgggcctcttggctgcatctctgatcagtcttctccttgtatgagctgaaagtt

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU814250 True 551 lncRNA 0.45 1 48827976 48828526
Loading

Neighbor


gene id symbol gene type direction distance location
dlg1l LOC106568684 coding downstream 211388 48356004 ~ 48616588 (-)
LOC118965521 NA coding downstream 291350 48531522 ~ 48536626 (-)
LOC110529989 LOC106568683 coding downstream 484966 48329684 ~ 48343010 (-)
LOC110529987 LOC106568679 coding downstream 933800 47726790 ~ 47894176 (-)
LOC110529117 NA coding downstream 1171908 47655052 ~ 47656068 (-)
LOC110529994 LOC106568693 coding upstream 293523 49122049 ~ 49140712 (-)
LOC118965653 NA coding upstream 568273 49396799 ~ 49396853 (-)
LOC110529999 LOC106568697 coding upstream 614182 49442708 ~ 49491248 (-)
LOC110530002 LOC106568700 coding upstream 696212 49524738 ~ 49529686 (-)
LOC118965614 NA coding upstream 748577 49577103 ~ 49578807 (-)
G716496 NA non-coding downstream 21723 48803552 ~ 48806253 (-)
G716484 NA non-coding downstream 42757 48784921 ~ 48785219 (-)
G716483 tnk2 non-coding downstream 43153 48784415 ~ 48784823 (-)
G716470 NA non-coding downstream 57147 48770614 ~ 48770829 (-)
G716466 NA non-coding downstream 64363 48763327 ~ 48763613 (-)
G716512 NA non-coding upstream 4677 48833203 ~ 48833545 (-)
G716513 NA non-coding upstream 5169 48833695 ~ 48833915 (-)
G716529 NA non-coding upstream 28373 48856899 ~ 48857104 (-)
G716543 NA non-coding upstream 36522 48865048 ~ 48865299 (-)
G716560 NA non-coding upstream 48971 48877497 ~ 48877719 (-)
G716488 NA other downstream 39014 48788521 ~ 48788962 (-)
G716480 tnk2 other downstream 45461 48782121 ~ 48782515 (-)
G716463 LOC106591423 other downstream 66813 48759912 ~ 48761163 (-)
G715865 NA other downstream 538395 48288942 ~ 48289581 (-)
G718489 NA other upstream 957148 49785674 ~ 49837696 (-)
LOC110530011 LOC106568709 other upstream 1038104 49866272 ~ 49937001 (-)
G719151 NA other upstream 2108402 50936928 ~ 50939471 (-)
LOC110530043 LOC106568739 other upstream 2423829 51252355 ~ 51259061 (-)
G721275 NA other upstream 3932513 52761039 ~ 52761451 (-)

Expression


G716509 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G716509 Expression in each Bioproject

Bar chart with 20 bars.
G716509 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network