G716543



Basic Information


Item Value
gene id G716543
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 48865048 ~ 48865299 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU814284
cgctagatgtcctctttcattagagctttgaatcgttcaaatcccgcgagaattgaccctatgggagtgaaattagtgcgtgccacgagagaataggctgtgcgtatgggcgcgaattggtcccagccattcctttgttccagcactcaagagaagagcagacgatggccgattgaattgatgttttgcgtgtctaaaacatcataaagcttgcttctgcacttagtttgacctgtttagtcgacatataat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU814284 True 252 lncRNA 0.45 1 48865048 48865299
Loading

Neighbor


gene id symbol gene type direction distance location
dlg1l LOC106568684 coding downstream 248460 48356004 ~ 48616588 (-)
LOC118965521 NA coding downstream 328422 48531522 ~ 48536626 (-)
LOC110529989 LOC106568683 coding downstream 522038 48329684 ~ 48343010 (-)
LOC110529987 LOC106568679 coding downstream 970872 47726790 ~ 47894176 (-)
LOC110529117 NA coding downstream 1208980 47655052 ~ 47656068 (-)
LOC110529994 LOC106568693 coding upstream 256750 49122049 ~ 49140712 (-)
LOC118965653 NA coding upstream 531500 49396799 ~ 49396853 (-)
LOC110529999 LOC106568697 coding upstream 577409 49442708 ~ 49491248 (-)
LOC110530002 LOC106568700 coding upstream 659439 49524738 ~ 49529686 (-)
LOC118965614 NA coding upstream 711804 49577103 ~ 49578807 (-)
G716529 NA non-coding downstream 7944 48856899 ~ 48857104 (-)
G716513 NA non-coding downstream 31133 48833695 ~ 48833915 (-)
G716512 NA non-coding downstream 31503 48833203 ~ 48833545 (-)
G716509 NA non-coding downstream 36522 48827976 ~ 48828526 (-)
G716496 NA non-coding downstream 58795 48803552 ~ 48806253 (-)
G716560 NA non-coding upstream 12198 48877497 ~ 48877719 (-)
G717227 NA non-coding upstream 194448 49059747 ~ 49114775 (-)
G717282 NA non-coding upstream 282268 49147567 ~ 49147789 (-)
G717289 NA non-coding upstream 290672 49155971 ~ 49156225 (-)
G717291 NA non-coding upstream 291929 49157228 ~ 49157718 (-)
G716488 NA other downstream 76086 48788521 ~ 48788962 (-)
G716480 tnk2 other downstream 82533 48782121 ~ 48782515 (-)
G716463 LOC106591423 other downstream 103885 48759912 ~ 48761163 (-)
G715865 NA other downstream 575467 48288942 ~ 48289581 (-)
G718489 NA other upstream 920375 49785674 ~ 49837696 (-)
LOC110530011 LOC106568709 other upstream 1001331 49866272 ~ 49937001 (-)
G719151 NA other upstream 2071629 50936928 ~ 50939471 (-)
LOC110530043 LOC106568739 other upstream 2387056 51252355 ~ 51259061 (-)
G721275 NA other upstream 3895740 52761039 ~ 52761451 (-)

Expression


G716543 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G716543 Expression in each Bioproject

Bar chart with 10 bars.
G716543 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network