G717307



Basic Information


Item Value
gene id G717307
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49178519 ~ 49179035 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU815079
aactgtatttttttgtgaagaatcaacaacaaatgggacacaatcatgaagtggaacgacatttattggatatttcaaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagcccctttactttcagtgcagcaaactctctccagaagttcagtcaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaagtagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggtcgtccctctaaactttcagctcatacaaggag

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU815079 True 517 lncRNA 0.39 1 49178519 49179035
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529994 LOC106568693 coding downstream 37807 49122049 ~ 49140712 (-)
dlg1l LOC106568684 coding downstream 561931 48356004 ~ 48616588 (-)
LOC118965521 NA coding downstream 641893 48531522 ~ 48536626 (-)
LOC110529989 LOC106568683 coding downstream 835509 48329684 ~ 48343010 (-)
LOC110529987 LOC106568679 coding downstream 1284343 47726790 ~ 47894176 (-)
LOC118965653 NA coding upstream 217764 49396799 ~ 49396853 (-)
LOC110529999 LOC106568697 coding upstream 263673 49442708 ~ 49491248 (-)
LOC110530002 LOC106568700 coding upstream 345703 49524738 ~ 49529686 (-)
LOC118965614 NA coding upstream 398068 49577103 ~ 49578807 (-)
LOC110530004 LOC106568703 coding upstream 422504 49601539 ~ 49612229 (-)
G717298 NA non-coding downstream 12291 49165939 ~ 49166228 (-)
G717297 NA non-coding downstream 12708 49165364 ~ 49165811 (-)
G717291 NA non-coding downstream 20801 49157228 ~ 49157718 (-)
G717289 NA non-coding downstream 22294 49155971 ~ 49156225 (-)
G717282 NA non-coding downstream 30730 49147567 ~ 49147789 (-)
G717359 NA non-coding upstream 64632 49243667 ~ 49244003 (-)
G717374 NA non-coding upstream 87115 49266150 ~ 49266351 (-)
G717385 LOC106568695 non-coding upstream 99998 49279033 ~ 49280289 (-)
G717390 NA non-coding upstream 109754 49288789 ~ 49288992 (-)
G717415 NA non-coding upstream 140269 49319304 ~ 49319523 (-)
G716488 NA other downstream 389557 48788521 ~ 48788962 (-)
G716480 tnk2 other downstream 396004 48782121 ~ 48782515 (-)
G716463 LOC106591423 other downstream 417356 48759912 ~ 48761163 (-)
G715865 NA other downstream 888938 48288942 ~ 48289581 (-)
G718489 NA other upstream 606639 49785674 ~ 49837696 (-)
LOC110530011 LOC106568709 other upstream 687595 49866272 ~ 49937001 (-)
G719151 NA other upstream 1757893 50936928 ~ 50939471 (-)
LOC110530043 LOC106568739 other upstream 2073320 51252355 ~ 51259061 (-)
G721275 NA other upstream 3582004 52761039 ~ 52761451 (-)

Expression


G717307 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G717307 Expression in each Bioproject

Bar chart with 13 bars.
G717307 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network