G717374



Basic Information


Item Value
gene id G717374
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49266150 ~ 49266351 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU815147
ggacaaaaggaacacctatgtgagaatgctgttcattgactacagctcagcattcaacactatagtgcccatgaagctcatcactaagctaaggaccctgggacaaaacacctccttttgcatctggatcctggacttcctgacgggagccaccaggtggtaagggtaggcaacagcacgtctgccactctgatcctcaaca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU815147 True 202 lncRNA 0.50 1 49266150 49266351
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529994 LOC106568693 coding downstream 125438 49122049 ~ 49140712 (-)
dlg1l LOC106568684 coding downstream 649562 48356004 ~ 48616588 (-)
LOC118965521 NA coding downstream 729524 48531522 ~ 48536626 (-)
LOC110529989 LOC106568683 coding downstream 923140 48329684 ~ 48343010 (-)
LOC110529987 LOC106568679 coding downstream 1371974 47726790 ~ 47894176 (-)
LOC118965653 NA coding upstream 130448 49396799 ~ 49396853 (-)
LOC110529999 LOC106568697 coding upstream 176357 49442708 ~ 49491248 (-)
LOC110530002 LOC106568700 coding upstream 258387 49524738 ~ 49529686 (-)
LOC118965614 NA coding upstream 310752 49577103 ~ 49578807 (-)
LOC110530004 LOC106568703 coding upstream 335188 49601539 ~ 49612229 (-)
G717359 NA non-coding downstream 22147 49243667 ~ 49244003 (-)
G717307 NA non-coding downstream 87115 49178519 ~ 49179035 (-)
G717298 NA non-coding downstream 99922 49165939 ~ 49166228 (-)
G717297 NA non-coding downstream 100339 49165364 ~ 49165811 (-)
G717291 NA non-coding downstream 108432 49157228 ~ 49157718 (-)
G717385 LOC106568695 non-coding upstream 12682 49279033 ~ 49280289 (-)
G717390 NA non-coding upstream 22438 49288789 ~ 49288992 (-)
G717415 NA non-coding upstream 52953 49319304 ~ 49319523 (-)
G717418 NA non-coding upstream 63361 49329712 ~ 49329973 (-)
G717424 LOC106568695 non-coding upstream 78875 49345226 ~ 49345512 (-)
G716488 NA other downstream 477188 48788521 ~ 48788962 (-)
G716480 tnk2 other downstream 483635 48782121 ~ 48782515 (-)
G716463 LOC106591423 other downstream 504987 48759912 ~ 48761163 (-)
G715865 NA other downstream 976569 48288942 ~ 48289581 (-)
G718489 NA other upstream 519323 49785674 ~ 49837696 (-)
LOC110530011 LOC106568709 other upstream 600279 49866272 ~ 49937001 (-)
G719151 NA other upstream 1670577 50936928 ~ 50939471 (-)
LOC110530043 LOC106568739 other upstream 1986004 51252355 ~ 51259061 (-)
G721275 NA other upstream 3494688 52761039 ~ 52761451 (-)

Expression


G717374 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G717374 Expression in each Bioproject

Bar chart with 12 bars.
G717374 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network