G716862



Basic Information


Item Value
gene id G716862
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49332841 ~ 49333772 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU814604
tacagtgccttgcgaaagtattcggcccccttgaactttgcgaccttttgccacatttcaggcttcaaacataaagatataaaactgtatttttttgtgaagaatcaacaacaagtgggacacaatcatgaagtggaacgacatttattggatatttcaaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcaacccctttactttcagtgcagcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaatatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagccgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccctaaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctgaacacaccatccccac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU814604 True 932 TUCP 0.42 1 49332841 49333772

Neighbor


gene id symbol gene type direction distance location
LOC110530924 LOC106568797 coding upstream 123687 49206999 ~ 49209154 (+)
LOC110529995 LOC106568692 coding upstream 134662 49147967 ~ 49198179 (+)
adipoqb LOC100653481 coding upstream 212532 49117727 ~ 49120309 (+)
LOC110530923 LOC106568690 coding upstream 401163 48902937 ~ 48931678 (+)
tnk2b tnk2 coding upstream 529424 48678813 ~ 48806257 (+)
LOC110529997 LOC106568696 coding downstream 53393 49387165 ~ 49420283 (+)
LOC110530001 LOC106568699 coding downstream 173012 49506784 ~ 49566389 (+)
LOC110530003 LOC106568702 coding downstream 257458 49591230 ~ 49600103 (+)
nyap2b LOC106568706 coding downstream 386890 49720662 ~ 49748389 (+)
LOC110530010 LOC106568707 coding downstream 441743 49775515 ~ 49846428 (+)
G716861 NA non-coding upstream 113 49332503 ~ 49332728 (+)
G716857 NA non-coding upstream 15363 49317216 ~ 49317478 (+)
G716839 NA non-coding upstream 34933 49297658 ~ 49297908 (+)
G716819 NA non-coding upstream 66400 49266234 ~ 49266441 (+)
G716810 NA non-coding upstream 77385 49255240 ~ 49255456 (+)
G716863 NA non-coding downstream 8148 49341920 ~ 49342169 (+)
G716868 NA non-coding downstream 13617 49347389 ~ 49348115 (+)
G716871 NA non-coding downstream 17540 49351312 ~ 49351595 (+)
G716873 NA non-coding downstream 20190 49353962 ~ 49354187 (+)
G716877 NA non-coding downstream 24537 49358309 ~ 49358560 (+)
G716133 NA other upstream 572101 48760343 ~ 48760740 (+)
G716035 LOC106581475 other upstream 788677 48537743 ~ 48544164 (+)
G713574 NA other upstream 2563595 46715915 ~ 46769246 (+)
G713405 NA other upstream 2866614 46465398 ~ 46466227 (+)
G711912 NA other upstream 3538292 45793269 ~ 45794549 (+)
G716993 LOC100136012 other downstream 212440 49546212 ~ 49547085 (+)
LOC118965615 NA other downstream 519615 49853027 ~ 49854435 (+)
LOC110530019 LOC106568718 other downstream 1051774 50384296 ~ 50397007 (+)
LOC110530024 LOC106568723 other downstream 1302924 50607401 ~ 50641183 (+)
G721689 LOC106583873 other downstream 4043460 53377232 ~ 53377705 (+)

Expression


G716862 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G716862 Expression in each Bioproject

Bar chart with 20 bars.
G716862 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network