G717446



Basic Information


Item Value
gene id G717446
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49369688 ~ 49369932 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU815219
GTGGTCAGATAACACTTACAGTGAAGGATATTTCAAATAGGGAAGGAGGAATGTGTGTTTATGAGAAAAAGTATTTGTTGGAAAGATCACTGATGCTAAGGTCTACATATTTGGTTTATCTGCTACAACGGTAAGCAATCTCAGTCACACAATCCATCATAAAATATTCTACAAATCTCTGTTGATATAGTAGTATATGTCATAGCCTTGTGGCCGGTTCAAAATCAAAGTACTGACAGGATGAA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU815219 True 245 lncRNA 0.36 1 49369688 49369932
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529994 LOC106568693 coding downstream 228976 49122049 ~ 49140712 (-)
dlg1l LOC106568684 coding downstream 753100 48356004 ~ 48616588 (-)
LOC118965521 NA coding downstream 833062 48531522 ~ 48536626 (-)
LOC110529989 LOC106568683 coding downstream 1026678 48329684 ~ 48343010 (-)
LOC110529987 LOC106568679 coding downstream 1475512 47726790 ~ 47894176 (-)
LOC118965653 NA coding upstream 26867 49396799 ~ 49396853 (-)
LOC110529999 LOC106568697 coding upstream 72776 49442708 ~ 49491248 (-)
LOC110530002 LOC106568700 coding upstream 154806 49524738 ~ 49529686 (-)
LOC118965614 NA coding upstream 207171 49577103 ~ 49578807 (-)
LOC110530004 LOC106568703 coding upstream 231607 49601539 ~ 49612229 (-)
G717440 LOC106568695 non-coding downstream 9710 49359616 ~ 49359978 (-)
G717425 NA non-coding downstream 23799 49345547 ~ 49345889 (-)
G717424 LOC106568695 non-coding downstream 24176 49345226 ~ 49345512 (-)
G717418 NA non-coding downstream 39715 49329712 ~ 49329973 (-)
G717415 NA non-coding downstream 50165 49319304 ~ 49319523 (-)
G717450 NA non-coding upstream 3631 49373563 ~ 49374056 (-)
G717452 NA non-coding upstream 6578 49376510 ~ 49376712 (-)
G717527 NA non-coding upstream 143143 49513075 ~ 49514522 (-)
G717528 NA non-coding upstream 146768 49516700 ~ 49516983 (-)
G716488 NA other downstream 580726 48788521 ~ 48788962 (-)
G716480 tnk2 other downstream 587173 48782121 ~ 48782515 (-)
G716463 LOC106591423 other downstream 608525 48759912 ~ 48761163 (-)
G715865 NA other downstream 1080107 48288942 ~ 48289581 (-)
G718489 NA other upstream 415742 49785674 ~ 49837696 (-)
LOC110530011 LOC106568709 other upstream 496698 49866272 ~ 49937001 (-)
G719151 NA other upstream 1566996 50936928 ~ 50939471 (-)
LOC110530043 LOC106568739 other upstream 1882423 51252355 ~ 51259061 (-)
G721275 NA other upstream 3391107 52761039 ~ 52761451 (-)

Expression


G717446 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.6.
End of interactive chart.

G717446 Expression in each Bioproject

Bar chart with 6 bars.
G717446 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network