G717532



Basic Information


Item Value
gene id G717532
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49521606 ~ 49521933 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU815312
ggaacataccggaccaatttttctctccatgtccctggatttcaactgctctctggacattcatacccggatctcacagctagctagctgctatccgtgtgacaatcggctttcgtcgattccggagcaaacatcaattattccggtgctagccagctccgtcaatcactcctgagttccatcattcactcctgggctgcagtcacctatccggacccgttttactgcctacgcggagccccaccgggccttcacaactggactgccgacgttatctacctgaaggagatccggctggctcctccgtcgcaacgttacctgaacgccc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU815312 True 328 lncRNA 0.55 1 49521606 49521933
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529999 LOC106568697 coding downstream 30358 49442708 ~ 49491248 (-)
LOC118965653 NA coding downstream 124753 49396799 ~ 49396853 (-)
LOC110529994 LOC106568693 coding downstream 380894 49122049 ~ 49140712 (-)
dlg1l LOC106568684 coding downstream 905018 48356004 ~ 48616588 (-)
LOC110530002 LOC106568700 coding upstream 2805 49524738 ~ 49529686 (-)
LOC118965614 NA coding upstream 55170 49577103 ~ 49578807 (-)
LOC110530004 LOC106568703 coding upstream 79606 49601539 ~ 49612229 (-)
LOC110530005 NA coding upstream 107644 49629577 ~ 49630769 (-)
LOC110530006 LOC106568704 coding upstream 113542 49635475 ~ 49647848 (-)
G717531 NA non-coding downstream 1108 49520154 ~ 49520498 (-)
G717528 NA non-coding downstream 4623 49516700 ~ 49516983 (-)
G717527 NA non-coding downstream 7084 49513075 ~ 49514522 (-)
G717452 NA non-coding downstream 144894 49376510 ~ 49376712 (-)
G717534 NA non-coding upstream 10054 49531987 ~ 49532535 (-)
G717539 NA non-coding upstream 21278 49543211 ~ 49544233 (-)
G717540 NA non-coding upstream 22865 49544798 ~ 49545015 (-)
G717542 NA non-coding upstream 24699 49546632 ~ 49546884 (-)
G717543 NA non-coding upstream 25740 49547673 ~ 49547973 (-)
G716488 NA other downstream 732644 48788521 ~ 48788962 (-)
G716480 tnk2 other downstream 739091 48782121 ~ 48782515 (-)
G716463 LOC106591423 other downstream 760443 48759912 ~ 48761163 (-)
G715865 NA other downstream 1232025 48288942 ~ 48289581 (-)
G718489 NA other upstream 263741 49785674 ~ 49837696 (-)
LOC110530011 LOC106568709 other upstream 344697 49866272 ~ 49937001 (-)
G719151 NA other upstream 1414995 50936928 ~ 50939471 (-)
LOC110530043 LOC106568739 other upstream 1730422 51252355 ~ 51259061 (-)
G721275 NA other upstream 3239106 52761039 ~ 52761451 (-)

Expression


G717532 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G717532 Expression in each Bioproject

Bar chart with 20 bars.
G717532 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network