G717549



Basic Information


Item Value
gene id G717549
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49552985 ~ 49553329 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU815329
CCGGTTTTGGTTCCATGTAAGGTGTAGGCAATACGGTGCCAATTCCACTTGGCCTAAGATGGGCTACCACCATATAGATTACACTTATCTAATCCTCTCAGATCTAAACAAGTGCCTAGGGGTAAGGGCAGATTTGTGATTAAGGGGGTATATTTCTATTTTCTCCCTATTCCTACAGCAGTGCTCACCCATGAGGATCTTGTCCTTGGCAAACTCCAGCTCTTTGAGGGTCACCATGTTTTTGCCATCCACCGCCGCTTTCAGAGCTGCCTGGTTCACCAGGTTCTCCAGGTCGGCCCCAGAGAAGCCCACTGTGCCCCTGGCGATGATCCCAGCCTCAATGTC

Function


NR:

description
ATP-dependent zinc metalloprotease YME1L1-like isoform X4

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU815329 True 345 lncRNA 0.50 1 49552985 49553329
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110530002 LOC106568700 coding downstream 23299 49524738 ~ 49529686 (-)
LOC110529999 LOC106568697 coding downstream 61737 49442708 ~ 49491248 (-)
LOC118965653 NA coding downstream 156132 49396799 ~ 49396853 (-)
LOC110529994 LOC106568693 coding downstream 412273 49122049 ~ 49140712 (-)
LOC118965521 NA coding downstream 1016359 48531522 ~ 48536626 (-)
LOC118965614 NA coding upstream 23774 49577103 ~ 49578807 (-)
LOC110530004 LOC106568703 coding upstream 48210 49601539 ~ 49612229 (-)
LOC110530005 NA coding upstream 76248 49629577 ~ 49630769 (-)
LOC110530006 LOC106568704 coding upstream 82146 49635475 ~ 49647848 (-)
zgc:110269 LOC106568705 coding upstream 94604 49647933 ~ 49655158 (-)
G717547 NA non-coding downstream 899 49551887 ~ 49552086 (-)
G717546 NA non-coding downstream 1939 49550822 ~ 49551046 (-)
G717544 NA non-coding downstream 3914 49548216 ~ 49549071 (-)
G717543 NA non-coding downstream 5012 49547673 ~ 49547973 (-)
G717542 NA non-coding downstream 6101 49546632 ~ 49546884 (-)
G717551 NA non-coding upstream 824 49554153 ~ 49554369 (-)
G717553 NA non-coding upstream 2945 49556274 ~ 49556634 (-)
G717554 NA non-coding upstream 3432 49556761 ~ 49556979 (-)
G717556 NA non-coding upstream 5536 49558865 ~ 49559082 (-)
G717560 NA non-coding upstream 14040 49567369 ~ 49567576 (-)
G716488 NA other downstream 764023 48788521 ~ 48788962 (-)
G716480 tnk2 other downstream 770470 48782121 ~ 48782515 (-)
G716463 LOC106591423 other downstream 791822 48759912 ~ 48761163 (-)
dlg1l LOC106568684 other downstream 936462 48356004 ~ 48616588 (-)
G715865 NA other downstream 1263404 48288942 ~ 48289581 (-)
G718489 NA other upstream 232345 49785674 ~ 49837696 (-)
LOC110530011 LOC106568709 other upstream 313301 49866272 ~ 49937001 (-)
G719151 NA other upstream 1383599 50936928 ~ 50939471 (-)
LOC110530043 LOC106568739 other upstream 1699026 51252355 ~ 51259061 (-)
G721275 NA other upstream 3207710 52761039 ~ 52761451 (-)

Expression


G717549 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.6.
End of interactive chart.

G717549 Expression in each Bioproject

Bar chart with 5 bars.
G717549 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3.
End of interactive chart.

Co-expression Network