G717554



Basic Information


Item Value
gene id G717554
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49556761 ~ 49556979 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU815334
GTAATGAACTCATTGCCAAATATGATTTCCTCTGCCACGCGGCCTCCCATGCTGACATCCATCTGGGCCAGCAGCTGAGCACGCGTCTCGCTCCAGCGGTCATCCTCCGGGAGCATAGACACCTAGGATGGACAGTGGGGGAAGAGGAGTGAGGCCTGGCAGCGAACGGAACCAACCACTTCAATTTGACGATTCTAAAAACATAAAAAACAATGATTT

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU815334 True 219 lncRNA 0.52 1 49556761 49556979

Neighbor


gene id symbol gene type direction distance location
LOC110530002 LOC106568700 coding downstream 27075 49524738 ~ 49529686 (-)
LOC110529999 LOC106568697 coding downstream 65513 49442708 ~ 49491248 (-)
LOC118965653 NA coding downstream 159908 49396799 ~ 49396853 (-)
LOC110529994 LOC106568693 coding downstream 416049 49122049 ~ 49140712 (-)
LOC118965521 NA coding downstream 1020135 48531522 ~ 48536626 (-)
LOC118965614 NA coding upstream 20124 49577103 ~ 49578807 (-)
LOC110530004 LOC106568703 coding upstream 44560 49601539 ~ 49612229 (-)
LOC110530005 NA coding upstream 72598 49629577 ~ 49630769 (-)
LOC110530006 LOC106568704 coding upstream 78496 49635475 ~ 49647848 (-)
zgc:110269 LOC106568705 coding upstream 90954 49647933 ~ 49655158 (-)
G717553 NA non-coding downstream 127 49556274 ~ 49556634 (-)
G717551 NA non-coding downstream 2392 49554153 ~ 49554369 (-)
G717549 NA non-coding downstream 3432 49552985 ~ 49553329 (-)
G717547 NA non-coding downstream 4675 49551887 ~ 49552086 (-)
G717546 NA non-coding downstream 5715 49550822 ~ 49551046 (-)
G717556 NA non-coding upstream 1886 49558865 ~ 49559082 (-)
G717560 NA non-coding upstream 10390 49567369 ~ 49567576 (-)
G717565 NA non-coding upstream 16869 49573848 ~ 49574098 (-)
G717525 NA non-coding upstream 34251 49591230 ~ 49593744 (-)
G716488 NA other downstream 767799 48788521 ~ 48788962 (-)
G716480 tnk2 other downstream 774246 48782121 ~ 48782515 (-)
G716463 LOC106591423 other downstream 795598 48759912 ~ 48761163 (-)
dlg1l LOC106568684 other downstream 940238 48356004 ~ 48616588 (-)
G715865 NA other downstream 1267180 48288942 ~ 48289581 (-)
G718489 NA other upstream 228695 49785674 ~ 49837696 (-)
LOC110530011 LOC106568709 other upstream 309651 49866272 ~ 49937001 (-)
G719151 NA other upstream 1379949 50936928 ~ 50939471 (-)
LOC110530043 LOC106568739 other upstream 1695376 51252355 ~ 51259061 (-)
G721275 NA other upstream 3204060 52761039 ~ 52761451 (-)

Expression


G717554 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G717554 Expression in each Bioproject

Bar chart with 8 bars.
G717554 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4.
End of interactive chart.

Co-expression Network