G717617



Basic Information


Item Value
gene id G717617
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 49667736 ~ 49672776 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU815408
gtcatgtactgtcatgttgtgtcttgtctctgtcctttcccttcaccctgtctccctctgctggtcgttgttaggttaccttttctccctctctttcccccagctgtgccttgtctcctcctaaccacctcgtcaccccgtttcccacctgttccctttttccctctgattaggtccctatatctctctctgtttttgttcctgtccttgtcggattcttgtttgttgtgtttcatgcctgaaccagactgtcgtcatgtttgctgtaaccttgtcttgtcctgtcggaatctgccggtccgtctgagcctacctatgtttggtaattaaagaagctctgtttaagttaattcgcttttgggtcctcattcacgcaccgtaaca

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU815408 True 384 lncRNA 0.48 2 49667736 49672776
Loading

Neighbor


gene id symbol gene type direction distance location
zgc:110269 LOC106568705 coding downstream 12578 49647933 ~ 49655158 (-)
LOC110530006 LOC106568704 coding downstream 19888 49635475 ~ 49647848 (-)
LOC110530005 NA coding downstream 36967 49629577 ~ 49630769 (-)
LOC110530004 LOC106568703 coding downstream 55507 49601539 ~ 49612229 (-)
LOC118965614 NA coding downstream 88929 49577103 ~ 49578807 (-)
LOC110530011 LOC106568709 coding upstream 193496 49866272 ~ 49937001 (-)
LOC118965522 NA coding upstream 208867 49881643 ~ 49886226 (-)
LOC110530012 LOC106568711 coding upstream 292138 49964914 ~ 49970082 (-)
LOC118965625 NA coding upstream 310613 49983389 ~ 49986205 (-)
LOC110530015 LOC106568800 coding upstream 420721 50093497 ~ 50095929 (-)
G717525 NA non-coding downstream 73992 49591230 ~ 49593744 (-)
G717565 NA non-coding downstream 93638 49573848 ~ 49574098 (-)
G717560 NA non-coding downstream 100160 49567369 ~ 49567576 (-)
G717622 NA non-coding upstream 5441 49678217 ~ 49683069 (-)
G718461 LOC106568706 non-coding upstream 69009 49741785 ~ 49742817 (-)
G718537 NA non-coding upstream 177465 49850241 ~ 49850528 (-)
G718541 NA non-coding upstream 182328 49855104 ~ 49855399 (-)
G718544 NA non-coding upstream 187188 49859964 ~ 49860783 (-)
G716488 NA other downstream 878774 48788521 ~ 48788962 (-)
G716480 tnk2 other downstream 885221 48782121 ~ 48782515 (-)
G716463 LOC106591423 other downstream 906573 48759912 ~ 48761163 (-)
dlg1l LOC106568684 other downstream 1051213 48356004 ~ 48616588 (-)
G715865 NA other downstream 1378155 48288942 ~ 48289581 (-)
G718489 NA other upstream 112898 49785674 ~ 49837696 (-)
G719151 NA other upstream 1264152 50936928 ~ 50939471 (-)
LOC110530043 LOC106568739 other upstream 1579579 51252355 ~ 51259061 (-)
G721275 NA other upstream 3088263 52761039 ~ 52761451 (-)

Expression


G717617 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G717617 Expression in each Bioproject

Bar chart with 20 bars.
G717617 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network