G718780



Basic Information


Item Value
gene id G718780
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 50241001 ~ 50241249 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU816673
gtagttaactagtgattatgattgattgttttttataagataagtttaatgctagctagcaacttaccttggcttactgcatttgcgtaacaggcagtcagtctccttgtggagtgcaacgagagaggcaggtcgtttttgcgttggactagttaactgtaaggttgcaagattggatcccccgagctgacaaggtgaaaatctgtctttctgcccctgaacgaggcagttaacccactgttcctaggc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU816673 True 249 lncRNA 0.44 1 50241001 50241249
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110530015 LOC106568800 coding downstream 145072 50093497 ~ 50095929 (-)
LOC118965625 NA coding downstream 254796 49983389 ~ 49986205 (-)
LOC110530012 LOC106568711 coding downstream 270919 49964914 ~ 49970082 (-)
LOC110530011 LOC106568709 coding downstream 304000 49866272 ~ 49937001 (-)
LOC118965522 NA coding downstream 354775 49881643 ~ 49886226 (-)
LOC110530016 LOC106568717 coding upstream 96482 50337731 ~ 50366270 (-)
LOC110530021 LOC106568720 coding upstream 171731 50412980 ~ 50434788 (-)
LOC110530027 LOC106568725 coding upstream 424382 50665631 ~ 50674317 (-)
LOC110530028 LOC106568726 coding upstream 436923 50678172 ~ 50685258 (-)
hsd17b7 LOC106568727 coding upstream 449098 50690347 ~ 50710421 (-)
G718648 LOC106568713 non-coding downstream 169018 50068513 ~ 50071983 (-)
G718663 LOC106568713 non-coding downstream 181426 50051445 ~ 50059575 (-)
G718625 NA non-coding downstream 239808 49994926 ~ 50001193 (-)
G718598 NA non-coding downstream 292878 49947768 ~ 49948123 (-)
G718594 NA non-coding downstream 296773 49943716 ~ 49944228 (-)
G718781 NA non-coding upstream 415 50241664 ~ 50241894 (-)
G718783 NA non-coding upstream 8609 50249858 ~ 50250116 (-)
G718784 NA non-coding upstream 9502 50250751 ~ 50251056 (-)
G718798 LOC106598425 non-coding upstream 56151 50297400 ~ 50383091 (-)
G718834 NA non-coding upstream 116064 50357313 ~ 50452833 (-)
G718489 NA other downstream 403305 49785674 ~ 49837696 (-)
G716488 NA other downstream 1452039 48788521 ~ 48788962 (-)
G716480 tnk2 other downstream 1458486 48782121 ~ 48782515 (-)
G716463 LOC106591423 other downstream 1479838 48759912 ~ 48761163 (-)
G719151 NA other upstream 695679 50936928 ~ 50939471 (-)
LOC110530043 LOC106568739 other upstream 1011106 51252355 ~ 51259061 (-)
G721275 NA other upstream 2519790 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 3221933 53462034 ~ 53478913 (-)
G722459 NA other upstream 3256899 53495804 ~ 53499730 (-)

Expression


G718780 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G718780 Expression in each Bioproject

Bar chart with 21 bars.
G718780 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network